HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA9097958: CB20.03C1a

Sample data for SAMEA9097958, a HoloFood host-genomic chicken sample


Sample details
Animal
Chicken SAMEA112904847
Sample type
Host genome data icon host-genomic
API endpoint
/api/samples/SAMEA9097958 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA9097958, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA9097958 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:21:43Z None
INSDC last update 2023-03-22T12:21:43Z None
INSDC status public None
SRA accession ERS6824089 None
Submitter Id CB20_03C1a_hostG None
adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT None
collection date 2019-05-06 None
common name chicken None
description Chicken host genomic data from Ileum content; animal CB20.03 from cage CB20 with treatment CC None
geographic location (country and/or sea) Spain None
geographic location (latitude) 41.17 DD
geographic location (longitude) 1.1685 DD
geographic location (region and locality) El Morell; Tarragona None
host body site Ileum content None
host breed Ross None
host common name Chicken None
host diet treatment Control None
host disease status Campylobacter:-;Salmonella:-;Clostridium:- None
host scientific name Gallus gallus None
host sex male None
host storage container temperature 21 °C
host subject id CB20.03 None
host taxid 9031 None
host total mass 197.4 g
library name BEST None
library selection PCR None
nucleic acid extraction D-rex protocol None
organism Gallus gallus None
project HoloFood None
project name HoloFood Chicken - Host Genome None
reference host genome for decontamination GCF_000002315.6 None
sample storage buffer Shield None
sample storage container E-matrix 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name Gallus gallus None
sequencing method MGISEQ-2000 None
title CB20.03C1a None
trial length 35 day
trial timepoint 7 day

Sample metadata

Marker Measurement Units
Body site ileum content None
Experiment genomics None
Index PCR cycles 6 None
Lab Process ID LPC00216 None
Organism Chicken None
Pool IC-MAG-12-529 None
Project HoloFood None
Raw sequence name F20FTSEUET0072_MICfuxR/IC-MAG-12/200707_I051_V300047602_L4_CDK153B200629008-529/V300047602_L04 None
Sample code CB20.03C1a None
Sequencing company BGI None
ng used for library build 276.8 None

Treatment metadata

Marker Measurement Units
Treatment code CC None
Treatment name Control None

Trial metadata

Marker Measurement Units
Trial code CB None
Trial description Trial 2 None
Trial end 2019-05-19 None
Trial start 2019-04-21 None
Nucleotide sequencing data

Sample SAMEA9097958 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 99,527,498,628bp sequenced by 691,365,052 reads. View sample SAMEA9097958 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA9097958 CB20.03C1a
Reads (Run) ERR6210789 webin-reads-CB20_03C1a_hostG
Reads (Experiment) ERX5845911 DNBSEQ-G400 sequencing: Raw reads: CB20_03C1a_hostG
Project/Study PRJEB45273 HoloFood Chicken Host Genome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA9097958