HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA7817177: CC11.15C1a

Sample data for SAMEA7817177, a HoloFood metagenomic-assembly chicken sample


Sample details
Animal
Chicken SAMEA112905229
Sample type
Metagenomic / metatranscriptomic data icon metagenomic-assembly
API endpoint
/api/samples/SAMEA7817177 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA7817177, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2022-08-02 None
ENA-LAST-UPDATE 2022-08-02 None
External Id SAMEA7817177 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2022-08-02T16:46:29Z None
INSDC last update 2022-08-02T16:46:29Z None
INSDC status public None
Organism Gallus gallus None
SRA accession ERS5564383 None
Submitter Id CC11_15C1a_metaG_rev None
adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT None
collection date 2019-10-15 None
description chicken MAG catalogue data from Ileum content; animal CC11.15 from cage CC11 with treatment CC None
geographic location (country and/or sea) Spain None
geographic location (latitude) 41.17 DD
geographic location (longitude) 1.1685 DD
geographic location (region and locality) El Morell; Tarragona None
host body site Ileum content None
host breed Cobb None
host common name Chicken None
host diet treatment Control None
host disease status Campylobacter:+;Salmonella:-;Clostridium:- None
host scientific name Gallus gallus None
host sex female None
host storage container temperature 21 °C
host subject id CC11.15 None
host taxid 9031 None
host total mass 2114 g
nucleic acid extraction D-rex protocol None
organism chicken gut metagenome None
project HoloFood None
project name HoloFood Chicken - MAG Catalogue from Ileum content None
reference host genome for decontamination GCF_000002315.6 None
sample storage buffer Shield None
sample storage container E-matrix 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
sequencing method MGISEQ-2000 None
title CC11.15C1a None
trial length 35 day
trial timepoint 35 day

Sample metadata

Marker Measurement Units
Body site ileum content None
Experiment metagenomics None
Index PCR cycles 6 None
Lab Process ID LPC00210 None
Organism Chicken None
Pool IC-MAG-14-532 None
Project HoloFood None
Raw sequence name F20FTSEUHT1189_GALvxbR/IC-MAG-14/DKBSP03472/201212_I095_V300074418_L3_CDK153B201127002-532/V300074418_L03 None
Sample code CC11.15C1a None
Sequencing company BGI None
ng used for library build 34.6 None

Treatment metadata

Marker Measurement Units
Treatment code CC None
Treatment name Control None

Trial metadata

Marker Measurement Units
Trial code CC None
Trial description Trial 3 None
Trial end 2019-07-14 None
Trial start 2019-06-09 None
Metagenomics

Sample SAMEA7817177 may have been analysed by MGnify. Lookup sample on MGnify

Analyses

Analysis accession Run/assembly accession MGnify pipeline version Experiment type Detail
MGYA00607576 ERR5100007 5.0 metagenomic View on MGnify
MGYA00607579 ERZ11751833 5.0 assembly View on MGnify
Nucleotide sequencing data

Sample SAMEA7817177 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 11,675,794,414bp sequenced by 82,856,356 reads. View sample SAMEA7817177 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA7817177 CC11.15C1a
Reads (Run) ERR5100007 webin-reads-CC11_15C1a_metaG
Reads (Experiment) ERX4905754 DNBSEQ-G400 paired end sequencing: Raw reads: CC11_15C1a_metaG
Project/Study PRJEB39110 HoloFood Chicken Caecum+Ileum Metagenome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA7817177