marker__name marker__type marker__canonical_url measurement units ENA-CHECKLIST ENA Checklist ERC000052 ENA-FIRST-PUBLIC ENA Checklist 2022-08-02 ENA-LAST-UPDATE ENA Checklist 2022-08-02 External Id ENA Checklist SAMEA7817177 INSDC center alias ENA Checklist UNIVERSITY OF COPENHAGEN INSDC center name ENA Checklist UNIVERSITY OF COPENHAGEN INSDC first public ENA Checklist 2022-08-02T16:46:29Z INSDC last update ENA Checklist 2022-08-02T16:46:29Z INSDC status ENA Checklist public Organism ENA Checklist Gallus gallus SRA accession ENA Checklist ERS5564383 Submitter Id ENA Checklist CC11_15C1a_metaG_rev adapters ENA Checklist AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT collection date ENA Checklist 2019-10-15 description ENA Checklist chicken MAG catalogue data from Ileum content; animal CC11.15 from cage CC11 with treatment CC geographic location (country and/or sea) ENA Checklist Spain geographic location (latitude) ENA Checklist 41.170047 DD geographic location (longitude) ENA Checklist 1.168491 DD geographic location (region and locality) ENA Checklist El Morell; Tarragona host body site ENA Checklist Ileum content host breed ENA Checklist Cobb host common name ENA Checklist Chicken host diet treatment ENA Checklist Control host disease status ENA Checklist Campylobacter:+;Salmonella:-;Clostridium:- host scientific name ENA Checklist Gallus gallus host sex ENA Checklist female host storage container temperature ENA Checklist 21 °C host subject id ENA Checklist CC11.15 host taxid ENA Checklist 9031 host total mass ENA Checklist 2114.0 g nucleic acid extraction ENA Checklist D-rex protocol organism ENA Checklist chicken gut metagenome project ENA Checklist HoloFood project name ENA Checklist HoloFood Chicken - MAG Catalogue from Ileum content reference host genome for decontamination ENA Checklist GCF_000002315.6 sample storage buffer ENA Checklist Shield sample storage container ENA Checklist E-matrix 2ml sample storage location ENA Checklist UCPH sample storage temperature ENA Checklist -20 °C sample volume or weight for DNA extraction ENA Checklist 0.2 mL sequencing method ENA Checklist MGISEQ-2000 title ENA Checklist CC11.15C1a trial length ENA Checklist 35 day trial timepoint ENA Checklist 35 day Body site SAMPLE ileum content Experiment SAMPLE metagenomics Index PCR cycles SAMPLE 6 Lab Process ID SAMPLE LPC00210 Organism SAMPLE Chicken Pool SAMPLE IC-MAG-14-532 Project SAMPLE HoloFood Raw sequence name SAMPLE F20FTSEUHT1189_GALvxbR/IC-MAG-14/DKBSP03472/201212_I095_V300074418_L3_CDK153B201127002-532/V300074418_L03 Sample code SAMPLE CC11.15C1a Sequencing company SAMPLE BGI ng used for library build SAMPLE 34.6 Treatment code TREATMENT CC Treatment name TREATMENT Control Trial code TRIAL CC Trial description TRIAL Trial 3 Trial end TRIAL 2019-07-14 Trial start TRIAL 2019-06-09