Could not connect to MGnify right now. Please try later.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA7687899, a HoloFood metagenomic-assembly salmon sample
Metadata for sample SAMEA7687899, stored in BioSamples and ENA.
Download all as TSVMarker | Measurement | Units |
---|---|---|
ENA-CHECKLIST | ERC000052 | None |
ENA-FIRST-PUBLIC | 2022-08-02 | None |
ENA-LAST-UPDATE | 2022-08-02 | None |
External Id | SAMEA7687899 | None |
INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
INSDC center name | UNIVERSITY OF COPENHAGEN | None |
INSDC first public | 2022-08-02T16:46:25Z | None |
INSDC last update | 2022-08-02T16:46:25Z | None |
INSDC status | public | None |
Organism | Salmo salar | None |
SRA accession | ERS5444429 | None |
Submitter Id | SA01_26C1a_metaG | None |
adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT | None |
collection date | 2019-08-12 | None |
description | Salmon metagenomic DNA data from Distal gut content; animal SA01.26 from tank SA01 with treatment Tiger | None |
geographic location (country and/or sea) | Norway | None |
geographic location (latitude) | 66.08 | DD |
geographic location (longitude) | 12.588 | DD |
geographic location (region and locality) | Dønna; Nordland county | None |
host body site | Distal gut content | None |
host common name | Atlantic salmon | None |
host diet | Fermented algae meal (added in in oil coating) | None |
host diet treatment | Tiger: SA Control | None |
host diet treatment concentration | 0 | % mass |
host disease status | Wounded:- | None |
host gutted mass | 443.8 | g |
host length | 34 | cm |
host scientific name | Salmo salar | None |
host storage container | LetSea Tank: Tiger | None |
host storage container pH | 7.05 | None |
host storage container temperature | 12.76 | °C |
host subject id | SA01.26 | None |
host taxid | 8030 | None |
host total mass | 534.4 | g |
nucleic acid extraction | D-rex protocol | None |
organism | fish gut metagenome | None |
project | HoloFood | None |
project name | HoloFood Salmon - Metagenomic DNA | None |
reference host genome for decontamination | GCA_000000000.0 | None |
sample storage buffer | Shield | None |
sample storage container | 2ml E-matrix | None |
sample storage location | UCPH | None |
sample storage temperature | -20 | °C |
sample volume or weight for DNA extraction | 0.2 | mL |
sequencing method | MGISEQ-2000 | None |
title | SA01.26C1a | None |
trial timepoint | 60 | day |
Marker | Measurement | Units |
---|---|---|
Body site | distal gut content | None |
Experiment | metagenomics | None |
Index PCR cycles | 12 | None |
Lab Process ID | LPS00646 | None |
Omics | Metagenomics | None |
Organism | Salmon | None |
Pool | S-MG-P29-503 | None |
Project | HoloFood | None |
Raw seq. name | S-MG-P29-503/V300074385_L01_503 | None |
Sample code | SA01.26C1a | None |
Sequencing company | BGI | None |
Marker | Measurement | Units |
---|---|---|
Treatment code | Tiger | None |
Treatment concentration | 0.0% | % |
Treatment description | Fermented algae meal (added in in oil coating) | None |
Marker | Measurement | Units |
---|---|---|
Environment | Tanks (flow-through) | None |
Trial code | SA | None |
Trial description | Trial A: Seaweed-dose response | None |
Trial end | 2019-08-13 | None |
Trial start | 2019-06-11 | None |
Sample SAMEA7687899 may have been analysed by MGnify. Lookup sample on MGnify
Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
---|
No analyses found in MGnify
Sample SAMEA7687899 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 56,299,616bp sequenced by 397,010 reads. View sample SAMEA7687899 in ENA
Data domain | Accession | Title/alias |
---|---|---|
Sample | SAMEA7687899 | SA01.26C1a |
Reads (Run) | ERR4918408 | webin-reads-SA01_26C1a_metaG |
Reads (Experiment) | ERX4783317 | DNBSEQ-G400 paired end sequencing: Raw reads: SA01_26C1a_metaG |
Project/Study | PRJEB41657 | HoloFood Salmon Trial A+B Gut Metagenome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA7687899