Could not connect to MGnify right now. Please try later.
HoloFood Data Portal
Access samples and data collected and generated by the HoloFood project.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA7571794, a HoloFood metagenomic-assembly chicken sample
Metadata for sample SAMEA7571794, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-03-22 | None |
| ENA-LAST-UPDATE | 2023-03-22 | None |
| External Id | SAMEA7571794 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-03-22T12:21:26Z | None |
| INSDC last update | 2023-03-22T12:21:26Z | None |
| INSDC status | public | None |
| SRA accession | ERS5328415 | None |
| Submitter Id | CA24_16F1a_metaG | None |
| adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT | None |
| collection date | 2019-03-12 | None |
| description | Prior chicken data from Caecum content; animal CA24.16 from cage CA24 with treatment CE | None |
| geographic location (country and/or sea) | Spain | None |
| geographic location (latitude) | 41.17 | DD |
| geographic location (longitude) | 1.1685 | DD |
| geographic location (region and locality) | El Morell; Tarragona | None |
| host body site | Caecum content | None |
| host breed | Ross | None |
| host common name | Chicken | None |
| host diet treatment | Prebiotic | None |
| host disease status | Campylobacter:-;Salmonella:-;Clostridium:- | None |
| host scientific name | Gallus gallus | None |
| host sex | female | None |
| host storage container temperature | 21 | °C |
| host subject id | CA24.16 | None |
| host taxid | 9031 | None |
| host total mass | 1940.2 | g |
| nucleic acid extraction | D-rex protocol | None |
| organism | chicken gut metagenome | None |
| project | HoloFood | None |
| project name | HoloFood Chicken - Prior Chicken | None |
| reference host genome for decontamination | GCF_000002315.6 | None |
| sample storage buffer | Shield | None |
| sample storage container | E-matrix 2ml | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | chicken gut metagenome | None |
| sequencing method | MGISEQ-2000 | None |
| title | CA24.16F1a | None |
| trial length | 35 | day |
| trial timepoint | 35 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | caecum content | None |
| Experiment | metagenomics | None |
| Index PCR cycles | 6 | None |
| Lab Process ID | LPC00063 | None |
| Organism | Chicken | None |
| Pool | PRICH-04BM-521 | None |
| Project | HoloFood | None |
| Raw sequence name | F20FTSEUET0072_GALojaR/PRICH-04BM-521/V300066406_L02_521 | None |
| Sample code | CA24.16F1a | None |
| Sequencing company | BGI | None |
| ng used for library build | 379.4 | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | CE | None |
| Treatment name | Prebiotic | None |
| Marker | Measurement | Units |
|---|---|---|
| Trial code | CA | None |
| Trial description | Trial 1 | None |
| Trial end | 2019-03-11 | None |
| Trial start | 2019-02-04 | None |
Sample SAMEA7571794 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
|---|
No analyses found in MGnify
Sample SAMEA7571794 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 6,940,866,730bp sequenced by 47,548,246 reads. View sample SAMEA7571794 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA7571794 | CA24.16F1a |
| Reads (Run) | ERR4835934 | webin-reads-CA24_16F1a_metaG |
| Reads (Experiment) | ERX4705712 | DNBSEQ-G400 paired end sequencing: Raw reads: CA24_16F1a_metaG |
| Project/Study | PRJEB41323 | HoloFood Chicken Caecum Metagenome – deeply sequenced batch |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA7571794