HoloFood Data Portal
Access samples and data collected and generated by the HoloFood project.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA7368184, a HoloFood metagenomic-assembly chicken sample
Metadata for sample SAMEA7368184, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2022-08-02 | None |
| ENA-LAST-UPDATE | 2022-08-02 | None |
| External Id | SAMEA7368184 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2022-08-02T16:46:20Z | None |
| INSDC last update | 2022-08-02T16:46:20Z | None |
| INSDC status | public | None |
| Organism | Gallus gallus | None |
| SRA accession | ERS5126637 | None |
| Submitter Id | CB07_06C1a_metaG | None |
| adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT | None |
| collection date | 2019-05-07 | None |
| description | chicken MAG catalogue data from Ileum content; animal CB07.06 from cage CB07 with treatment CE | None |
| geographic location (country and/or sea) | Spain | None |
| geographic location (latitude) | 41.17 | DD |
| geographic location (longitude) | 1.1685 | DD |
| geographic location (region and locality) | El Morell; Tarragona | None |
| host body site | Ileum content | None |
| host breed | Cobb | None |
| host common name | Chicken | None |
| host diet treatment | Prebiotic | None |
| host scientific name | Gallus gallus | None |
| host sex | male | None |
| host storage container temperature | 21 | °C |
| host subject id | CB07.06 | None |
| host taxid | 9031 | None |
| host total mass | 226.8 | g |
| nucleic acid extraction | D-rex protocol | None |
| organism | chicken gut metagenome | None |
| project | HoloFood | None |
| project name | HoloFood Chicken - MAG Catalogue from Ileum content | None |
| reference host genome for decontamination | GCF_000002315.6 | None |
| sample storage buffer | Shield | None |
| sample storage container | E-matrix 2ml | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| sequencing method | MGISEQ-2000 | None |
| title | CB07.06C1a | None |
| trial length | 35 | day |
| trial timepoint | 7 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | ileum content | None |
| Experiment | metagenomics | None |
| Index PCR cycles | 8 | None |
| Lab Process ID | LPC00223 | None |
| Organism | Chicken | None |
| Pool | IC-MAG-04-532 | None |
| Project | HoloFood | None |
| Raw sequence name | F20FTSEUET0072_MICfuxR/IC-MAG-04/200707_I051_V300047396_L1_CDK153B200629001-532/V300047396_L01 | None |
| Sample code | CB07.06C1a | None |
| Sequencing company | BGI | None |
| ng used for library build | 212.8 | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | CE | None |
| Treatment name | Prebiotic | None |
| Marker | Measurement | Units |
|---|---|---|
| Trial code | CB | None |
| Trial description | Trial 2 | None |
| Trial end | 2019-05-19 | None |
| Trial start | 2019-04-21 | None |
Sample SAMEA7368184 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
|---|---|---|---|---|
| MGYA00585549 | ERR4647694 | 5.0 | metagenomic | View on MGnify |
| MGYA00606112 | ERZ2654317 | 5.0 | assembly | View on MGnify |
Sample SAMEA7368184 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 1,859,001,984bp sequenced by 13,097,280 reads. View sample SAMEA7368184 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA7368184 | CB07.06C1a |
| Reads (Run) | ERR4647694 | webin-reads-CB07_06C1a_metaG |
| Reads (Experiment) | ERX4571404 | DNBSEQ-G400 paired end sequencing: Raw reads: CB07_06C1a_metaG |
| Project/Study | PRJEB39110 | HoloFood Chicken Caecum+Ileum Metagenome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA7368184
