HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA7025267: CB20.03F1a

Sample data for SAMEA7025267, a HoloFood metagenomic-assembly chicken sample


Sample details
Animal
Chicken SAMEA112904847
Sample type
Metagenomic / metatranscriptomic data icon metagenomic-assembly
API endpoint
/api/samples/SAMEA7025267 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA7025267, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2022-08-02 None
ENA-LAST-UPDATE 2022-08-02 None
External Id SAMEA7025267 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2022-08-02T16:46:14Z None
INSDC last update 2022-08-02T16:46:14Z None
INSDC status public None
Organism Gallus gallus None
SRA accession ERS4789477 None
Submitter Id CB20_03F1a_metaG None
adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT None
collection date 2019-05-06 None
description chicken MAG catalogue data from Caecum content; animal CB20.03 from cage CB20 with treatment CC None
geographic location (country and/or sea) Spain None
geographic location (latitude) 41.17 DD
geographic location (longitude) 1.1685 DD
geographic location (region and locality) El Morell; Tarragona None
host body site Caecum content None
host breed Ross None
host common name Chicken None
host diet treatment Control None
host scientific name Gallus gallus None
host sex male None
host storage container temperature 21 °C
host subject id CB20.03 None
host taxid 9031 None
host total mass 197.4 g
nucleic acid extraction D-rex protocol None
organism chicken gut metagenome None
project HoloFood None
project name HoloFood Chicken - MAG Catalogue from Caecum content None
reference host genome for decontamination GCA_000000000.0 None
sample storage buffer Shield None
sample storage container E-matrix 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
sequencing method MGISEQ-2000 None
title CB20.03F1a None
trial length 35 day
trial timepoint 7 day

Sample metadata

Marker Measurement Units
Body site caecum content None
Experiment metagenomics None
Index PCR cycles 9 None
Lab Process ID LPC00303 None
Organism Chicken None
Pool MAG05-501 None
Project HoloFood None
Raw sequence name F19FTSEUET0172_MICrccR/MAG05/200310_I076_V300038545_L2_CDK153B200227006-501/V300038545_L02_501 None
Sample code CB20.03F1a None
Sequencing company BGI None
ng used for library build 393.8 None

Treatment metadata

Marker Measurement Units
Treatment code CC None
Treatment name Control None

Trial metadata

Marker Measurement Units
Trial code CB None
Trial description Trial 2 None
Trial end 2019-05-19 None
Trial start 2019-04-21 None
Metagenomics

Sample SAMEA7025267 may have been analysed by MGnify. Lookup sample on MGnify

Analyses

Empty set icon

Could not connect to MGnify right now. Please try later.

Analysis accession Run/assembly accession MGnify pipeline version Experiment type Detail
Empty set icon

No analyses found in MGnify

Nucleotide sequencing data

Sample SAMEA7025267 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 16,713,155,641bp sequenced by 58,035,595 reads. View sample SAMEA7025267 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA7025267 CB20.03F1a
Reads (Run) ERR4303195 webin-reads-CB20_03F1a_metaG
Reads (Experiment) ERX4251904 DNBSEQ-G400 paired end sequencing: Raw reads: CB20_03F1a_metaG
Project/Study PRJEB39110 HoloFood Chicken Caecum+Ileum Metagenome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA7025267