Could not connect to MGnify right now. Please try later.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA7025262, a HoloFood metagenomic-assembly chicken sample
Metadata for sample SAMEA7025262, stored in BioSamples and ENA.
Download all as TSVMarker | Measurement | Units |
---|---|---|
ENA-CHECKLIST | ERC000052 | None |
ENA-FIRST-PUBLIC | 2022-08-02 | None |
ENA-LAST-UPDATE | 2022-08-02 | None |
External Id | SAMEA7025262 | None |
INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
INSDC center name | UNIVERSITY OF COPENHAGEN | None |
INSDC first public | 2022-08-02T16:46:14Z | None |
INSDC last update | 2022-08-02T16:46:14Z | None |
INSDC status | public | None |
Organism | Gallus gallus | None |
SRA accession | ERS4789472 | None |
Submitter Id | CB10_16F1a_metaG | None |
adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT | None |
collection date | 2019-06-04 | None |
description | chicken MAG catalogue data from Caecum content; animal CB10.16 from cage CB10 with treatment CC | None |
geographic location (country and/or sea) | Spain | None |
geographic location (latitude) | 41.17 | DD |
geographic location (longitude) | 1.1685 | DD |
geographic location (region and locality) | El Morell; Tarragona | None |
host body site | Caecum content | None |
host breed | Ross | None |
host common name | Chicken | None |
host diet treatment | Control | None |
host scientific name | Gallus gallus | None |
host sex | female | None |
host storage container temperature | 21 | °C |
host subject id | CB10.16 | None |
host taxid | 9031 | None |
host total mass | 2059.6 | g |
nucleic acid extraction | D-rex protocol | None |
organism | chicken gut metagenome | None |
project | HoloFood | None |
project name | HoloFood Chicken - MAG Catalogue from Caecum content | None |
reference host genome for decontamination | GCA_000000000.0 | None |
sample storage buffer | Shield | None |
sample storage container | E-matrix 2ml | None |
sample storage location | UCPH | None |
sample storage temperature | -20 | °C |
sample volume or weight for DNA extraction | 0.2 | mL |
sequencing method | MGISEQ-2000 | None |
title | CB10.16F1a | None |
trial length | 35 | day |
trial timepoint | 35 | day |
Marker | Measurement | Units |
---|---|---|
Body site | caecum content | None |
Experiment | metagenomics | None |
Index PCR cycles | 12 | None |
Lab Process ID | LPC00237 | None |
Organism | Chicken | None |
Pool | MAG13-527 | None |
Project | HoloFood | None |
Raw sequence name | F20FTSEUET0036_MICrpnR/MAG13/200310_I001_V300038517_L4_CDK153B200227004-527/V300038517_L04_527 | None |
Sample code | CB10.16F1a | None |
Sequencing company | BGI | None |
ng used for library build | 939.6 | None |
Marker | Measurement | Units |
---|---|---|
Treatment code | CC | None |
Treatment name | Control | None |
Marker | Measurement | Units |
---|---|---|
Trial code | CB | None |
Trial description | Trial 2 | None |
Trial end | 2019-05-19 | None |
Trial start | 2019-04-21 | None |
Sample SAMEA7025262 may have been analysed by MGnify. Lookup sample on MGnify
Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
---|
No analyses found in MGnify
Sample SAMEA7025262 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 17,078,736,610bp sequenced by 59,521,262 reads. View sample SAMEA7025262 in ENA
Data domain | Accession | Title/alias |
---|---|---|
Sample | SAMEA7025262 | CB10.16F1a |
Reads (Run) | ERR4303197 | webin-reads-CB10_16F1a_metaG |
Reads (Experiment) | ERX4251906 | DNBSEQ-G400 paired end sequencing: Raw reads: CB10_16F1a_metaG |
Project/Study | PRJEB39110 | HoloFood Chicken Caecum+Ileum Metagenome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA7025262