Could not connect to MGnify right now. Please try later.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA7025244, a HoloFood metagenomic-assembly chicken sample
Metadata for sample SAMEA7025244, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2022-08-02 | None |
| ENA-LAST-UPDATE | 2022-08-02 | None |
| External Id | SAMEA7025244 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2022-08-02T16:46:14Z | None |
| INSDC last update | 2022-08-02T16:46:14Z | None |
| INSDC status | public | None |
| Organism | Gallus gallus | None |
| SRA accession | ERS4789454 | None |
| Submitter Id | CA17_02F1a_metaG | None |
| adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT | None |
| collection date | 2019-02-11 | None |
| description | chicken MAG catalogue data from Caecum content; animal CA17.02 from cage CA17 with treatment CO | None |
| geographic location (country and/or sea) | Spain | None |
| geographic location (latitude) | 41.17 | DD |
| geographic location (longitude) | 1.1685 | DD |
| geographic location (region and locality) | El Morell; Tarragona | None |
| host body site | Caecum content | None |
| host breed | Ross | None |
| host common name | Chicken | None |
| host diet treatment | Probiotic | None |
| host scientific name | Gallus gallus | None |
| host sex | male | None |
| host storage container temperature | 21 | °C |
| host subject id | CA17.02 | None |
| host taxid | 9031 | None |
| host total mass | 192.2 | g |
| nucleic acid extraction | D-rex protocol | None |
| organism | chicken gut metagenome | None |
| project | HoloFood | None |
| project name | HoloFood Chicken - MAG Catalogue from Caecum content | None |
| reference host genome for decontamination | GCA_000000000.0 | None |
| sample storage buffer | Shield | None |
| sample storage container | E-matrix 2ml | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| sequencing method | MGISEQ-2000 | None |
| title | CA17.02F1a | None |
| trial length | 35 | day |
| trial timepoint | 7 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | caecum content | None |
| Experiment | metagenomics | None |
| Index PCR cycles | 12 | None |
| Lab Process ID | LPC00246 | None |
| Organism | Chicken | None |
| Pool | MAG12-526 | None |
| Project | HoloFood | None |
| Raw sequence name | F20FTSEUET0036_MICrpnR/MAG12/200310_I001_V300038517_L3_CDK153B200227003-526/V300038517_L03_526 | None |
| Sample code | CA17.02F1a | None |
| Sequencing company | BGI | None |
| ng used for library build | 222 | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | CO | None |
| Treatment name | Probiotic | None |
| Marker | Measurement | Units |
|---|---|---|
| Trial code | CA | None |
| Trial description | Trial 1 | None |
| Trial end | 2019-03-11 | None |
| Trial start | 2019-02-04 | None |
Sample SAMEA7025244 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
|---|
No analyses found in MGnify
Sample SAMEA7025244 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 11,620,561,127bp sequenced by 40,278,877 reads. View sample SAMEA7025244 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA7025244 | CA17.02F1a |
| Reads (Run) | ERR4303157 | webin-reads-CA17_02F1a_metaG |
| Reads (Experiment) | ERX4251866 | DNBSEQ-G400 paired end sequencing: Raw reads: CA17_02F1a_metaG |
| Project/Study | PRJEB39110 | HoloFood Chicken Caecum+Ileum Metagenome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA7025244