HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA14099423: CC08.13C1a

Sample data for SAMEA14099423, a HoloFood metagenomic-assembly chicken sample


Sample details
Animal
Chicken SAMEA112904743
Sample type
Metagenomic / metatranscriptomic data icon metagenomic-assembly
API endpoint
/api/samples/SAMEA14099423 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA14099423, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA14099423 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:22:39Z None
INSDC last update 2023-03-22T12:22:39Z None
INSDC status public None
SRA accession ERS11702511 None
Submitter Id CC08_13C1a_PCIC_rev_metaG None
adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC None
collection date 2019-10-14 None
common name Priority chicken ileum content None
description main associated run/experiment: ERR9612713/ERX9162937, merged from ERR6769662/ERX6393444 and ERR6785288/ERX6409068 (linked to this sample as well); Chicken meta genome data from Ileum content; animal CC08.13 from cage CC08 with treatment CC None
geographic location (country and/or sea) Spain None
geographic location (latitude) 41.17 DD
geographic location (longitude) 1.1685 DD
geographic location (region and locality) El Morell; Tarragona None
host body site Ileum content None
host breed Ross None
host common name Chicken None
host diet treatment Control None
host disease status Campylobacter:+;Salmonella:-;Clostridium:- None
host scientific name Gallus gallus None
host sex male None
host storage container temperature 21 °C
host subject id CC08.13 None
host taxid 9031 None
host total mass 1866 g
library name BEMT None
library selection PCR None
nucleic acid extraction D-rex protocol None
organism chicken gut metagenome None
project HoloFood None
project name HoloFood Chicken -- Prior Chicken Ileum None
reference host genome for decontamination GCF_000002315.6 None
sample storage buffer Shield None
sample storage container E-matrix 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name chicken gut metagenome None
sequencing method MGISEQ-2000 None
title CC08.13C1a None
trial length 35 day
trial timepoint 35 day

Sample metadata

Marker Measurement Units
Body site ileum content None
Experiment metagenomics None
Organism Chicken None
Project HoloFood None
Sample code CC08.13C1a None

Treatment metadata

Marker Measurement Units
Treatment code CC None
Treatment name Control None

Trial metadata

Marker Measurement Units
Trial code CC None
Trial description Trial 3 None
Trial end 2019-07-14 None
Trial start 2019-06-09 None
Metagenomics

Sample SAMEA14099423 may have been analysed by MGnify. Lookup sample on MGnify

Analyses

Empty set icon

Could not connect to MGnify right now. Please try later.

Analysis accession Run/assembly accession MGnify pipeline version Experiment type Detail
Empty set icon

No analyses found in MGnify

Nucleotide sequencing data

Sample SAMEA14099423 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 3,286,532,391bp sequenced by 23,275,522 reads. View sample SAMEA14099423 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA14099423 CC08.13C1a
Reads (Run) ERR9612713 webin-reads-CC08_13C1a_PCIC_rev_metaG
Reads (Experiment) ERX9162937 DNBSEQ-G400 sequencing: Raw reads: CC08_13C1a_PCIC_rev_metaG
Project/Study PRJEB47609 HoloFood Chicken Ileum Metagenome – deeply sequenced batch

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA14099423