HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA14099422: CB03.16F1a

Sample data for SAMEA14099422, a HoloFood metagenomic-assembly chicken sample


Sample details
Animal
Chicken SAMEA112905377
Sample type
Metagenomic / metatranscriptomic data icon metagenomic-assembly
API endpoint
/api/samples/SAMEA14099422 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA14099422, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2022-08-02 None
ENA-LAST-UPDATE 2022-08-02 None
External Id SAMEA14099422 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2022-08-02T16:47:43Z None
INSDC last update 2022-08-02T16:47:43Z None
INSDC status public None
Organism Gallus gallus None
SRA accession ERS11702510 None
Submitter Id CB03_16F1a_NTM_rev_metaG None
adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC None
collection date 2019-06-04 None
common name NTM caecum content None
description main associated run/experiment: ERR9612718/ERX9162941, merged from ERR4303137/ERX4251846 and ERR6785290/ERX6409070 (linked to this sample as well); Chicken meta genome data from Caecum content; animal CB03.16 from cage CB03 with treatment CC None
geographic location (country and/or sea) Spain None
geographic location (latitude) 41.17 DD
geographic location (longitude) 1.1685 DD
geographic location (region and locality) El Morell; Tarragona None
host body site Caecum content None
host breed Cobb None
host common name Chicken None
host diet treatment Control None
host disease status Campylobacter:-;Salmonella:-;Clostridium:- None
host scientific name Gallus gallus None
host sex male None
host storage container temperature 21 °C
host subject id CB03.16 None
host taxid 9031 None
host total mass 2547 g
library name BEMT None
library selection PCR None
nucleic acid extraction D-rex protocol None
organism chicken gut metagenome None
project HoloFood None
project name HoloFood Chicken -- None targeted metabolomic None
reference host genome for decontamination GCF_000002315.6 None
sample storage buffer Shield None
sample storage container E-matrix 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
sequencing method MGISEQ-2000 None
title CB03.16F1a None
trial length 35 day
trial timepoint 35 day

Sample metadata

Marker Measurement Units
Body site caecum content None
Experiment metagenomics None
Index PCR cycles 6 None
Lab Process ID LPC00301 None
Organism Chicken None
Pool MAG05-503 None
Project HoloFood None
Raw sequence name F19FTSEUET0172_MICrccR/MAG05/200310_I076_V300038545_L2_CDK153B200227006-503/V300038545_L02_503 None
Sample code CB03.16F1a None
Sequencing company BGI None
ng used for library build 392.4 None

Treatment metadata

Marker Measurement Units
Treatment code CC None
Treatment name Control None

Trial metadata

Marker Measurement Units
Trial code CB None
Trial description Trial 2 None
Trial end 2019-05-19 None
Trial start 2019-04-21 None
Metagenomics

Sample SAMEA14099422 may have been analysed by MGnify. Lookup sample on MGnify

Analyses

Analysis accession Run/assembly accession MGnify pipeline version Experiment type Detail
MGYA00635946 ERZ2641604 5.0 assembly View on MGnify
MGYA00688197 ERR9612718 5.0 metagenomic View on MGnify
MGYA00688267 ERR6785290 5.0 metagenomic View on MGnify
Nucleotide sequencing data

Sample SAMEA14099422 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 15,696,917,807bp sequenced by 108,372,822 reads. View sample SAMEA14099422 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA14099422 CB03.16F1a
Reads (Run) ERR9612718 webin-reads-CB03_16F1a_NTM_rev_metaG
Reads (Experiment) ERX9162941 DNBSEQ-G400 sequencing: Raw reads: CB03_16F1a_NTM_rev_metaG
Project/Study PRJEB47613 HoloFood Chicken Caecum+Ileum Metagenome – non-targeted metabolomics batch

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA14099422