 
            
                Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA14099422, a HoloFood metagenomic-assembly chicken sample
Metadata for sample SAMEA14099422, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units | 
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None | 
| ENA-FIRST-PUBLIC | 2022-08-02 | None | 
| ENA-LAST-UPDATE | 2022-08-02 | None | 
| External Id | SAMEA14099422 | None | 
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None | 
| INSDC center name | UNIVERSITY OF COPENHAGEN | None | 
| INSDC first public | 2022-08-02T16:47:43Z | None | 
| INSDC last update | 2022-08-02T16:47:43Z | None | 
| INSDC status | public | None | 
| Organism | Gallus gallus | None | 
| SRA accession | ERS11702510 | None | 
| Submitter Id | CB03_16F1a_NTM_rev_metaG | None | 
| adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC | None | 
| collection date | 2019-06-04 | None | 
| common name | NTM caecum content | None | 
| description | main associated run/experiment: ERR9612718/ERX9162941, merged from ERR4303137/ERX4251846 and ERR6785290/ERX6409070 (linked to this sample as well); Chicken meta genome data from Caecum content; animal CB03.16 from cage CB03 with treatment CC | None | 
| geographic location (country and/or sea) | Spain | None | 
| geographic location (latitude) | 41.17 | DD | 
| geographic location (longitude) | 1.1685 | DD | 
| geographic location (region and locality) | El Morell; Tarragona | None | 
| host body site | Caecum content | None | 
| host breed | Cobb | None | 
| host common name | Chicken | None | 
| host diet treatment | Control | None | 
| host disease status | Campylobacter:-;Salmonella:-;Clostridium:- | None | 
| host scientific name | Gallus gallus | None | 
| host sex | male | None | 
| host storage container temperature | 21 | °C | 
| host subject id | CB03.16 | None | 
| host taxid | 9031 | None | 
| host total mass | 2547 | g | 
| library name | BEMT | None | 
| library selection | PCR | None | 
| nucleic acid extraction | D-rex protocol | None | 
| organism | chicken gut metagenome | None | 
| project | HoloFood | None | 
| project name | HoloFood Chicken -- None targeted metabolomic | None | 
| reference host genome for decontamination | GCF_000002315.6 | None | 
| sample storage buffer | Shield | None | 
| sample storage container | E-matrix 2ml | None | 
| sample storage location | UCPH | None | 
| sample storage temperature | -20 | °C | 
| sample volume or weight for DNA extraction | 0.2 | mL | 
| sequencing method | MGISEQ-2000 | None | 
| title | CB03.16F1a | None | 
| trial length | 35 | day | 
| trial timepoint | 35 | day | 
| Marker | Measurement | Units | 
|---|---|---|
| Body site | caecum content | None | 
| Experiment | metagenomics | None | 
| Index PCR cycles | 6 | None | 
| Lab Process ID | LPC00301 | None | 
| Organism | Chicken | None | 
| Pool | MAG05-503 | None | 
| Project | HoloFood | None | 
| Raw sequence name | F19FTSEUET0172_MICrccR/MAG05/200310_I076_V300038545_L2_CDK153B200227006-503/V300038545_L02_503 | None | 
| Sample code | CB03.16F1a | None | 
| Sequencing company | BGI | None | 
| ng used for library build | 392.4 | None | 
| Marker | Measurement | Units | 
|---|---|---|
| Treatment code | CC | None | 
| Treatment name | Control | None | 
| Marker | Measurement | Units | 
|---|---|---|
| Trial code | CB | None | 
| Trial description | Trial 2 | None | 
| Trial end | 2019-05-19 | None | 
| Trial start | 2019-04-21 | None | 
Sample SAMEA14099422 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail | 
|---|---|---|---|---|
| MGYA00635946 | ERZ2641604 | 5.0 | assembly | View on MGnify | 
| MGYA00688197 | ERR9612718 | 5.0 | metagenomic | View on MGnify | 
| MGYA00688267 | ERR6785290 | 5.0 | metagenomic | View on MGnify | 
Sample SAMEA14099422 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 15,696,917,807bp sequenced by 108,372,822 reads. View sample SAMEA14099422 in ENA
| Data domain | Accession | Title/alias | 
|---|---|---|
| Sample | SAMEA14099422 | CB03.16F1a | 
| Reads (Run) | ERR9612718 | webin-reads-CB03_16F1a_NTM_rev_metaG | 
| Reads (Experiment) | ERX9162941 | DNBSEQ-G400 sequencing: Raw reads: CB03_16F1a_NTM_rev_metaG | 
| Project/Study | PRJEB47613 | HoloFood Chicken Caecum+Ileum Metagenome – non-targeted metabolomics batch | 
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA14099422