Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA14095990, a HoloFood metagenomic-assembly chicken sample
Metadata for sample SAMEA14095990, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-03-22 | None |
| ENA-LAST-UPDATE | 2023-03-22 | None |
| External Id | SAMEA14095990 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-03-22T12:22:39Z | None |
| INSDC last update | 2023-03-22T12:22:39Z | None |
| INSDC status | public | None |
| SRA accession | ERS11699099 | None |
| Submitter Id | CA21_01F1a_metaG | None |
| adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC | None |
| collection date | 2019-02-11 | None |
| common name | Priority chicken caecum content | None |
| description | Chicken meta genome data from Caecum content; animal CA21.01 from cage CA21 with treatment CE | None |
| geographic location (country and/or sea) | Spain | None |
| geographic location (latitude) | 41.17 | DD |
| geographic location (longitude) | 1.1685 | DD |
| geographic location (region and locality) | El Morell; Tarragona | None |
| host body site | Caecum content | None |
| host breed | Ross | None |
| host common name | Chicken | None |
| host diet treatment | Prebiotic | None |
| host disease status | Campylobacter:-;Salmonella:-;Clostridium:- | None |
| host scientific name | Gallus gallus | None |
| host sex | male | None |
| host storage container temperature | 21 | °C |
| host subject id | CA21.01 | None |
| host taxid | 9031 | None |
| host total mass | 219.2 | g |
| library name | BEMT | None |
| library selection | PCR | None |
| nucleic acid extraction | D-rex protocol | None |
| organism | chicken gut metagenome | None |
| project | HoloFood | None |
| project name | HoloFood Chicken - Prior Chicken | None |
| reference host genome for decontamination | GCF_000002315.6 | None |
| sample storage buffer | Shield | None |
| sample storage container | E-matrix 2ml | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | chicken gut metagenome | None |
| sequencing method | MGISEQ-2000 | None |
| title | CA21.01F1a | None |
| trial length | 35 | day |
| trial timepoint | 7 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | caecum content | None |
| Experiment | metagenomics | None |
| Organism | Chicken | None |
| Project | HoloFood | None |
| Sample code | CA21.01F1a | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | CE | None |
| Treatment name | Prebiotic | None |
| Marker | Measurement | Units |
|---|---|---|
| Trial code | CA | None |
| Trial description | Trial 1 | None |
| Trial end | 2019-03-11 | None |
| Trial start | 2019-02-04 | None |
Sample SAMEA14095990 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
|---|---|---|---|---|
| MGYA00608303 | ERR9610037 | 5.0 | metagenomic | View on MGnify |
Sample SAMEA14095990 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 3,998,319,952bp sequenced by 27,695,798 reads. View sample SAMEA14095990 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA14095990 | CA21.01F1a |
| Reads (Run) | ERR9610037 | webin-reads-CA21_01F1a_metaG |
| Reads (Experiment) | ERX9160267 | DNBSEQ-G400 sequencing: Raw reads: CA21_01F1a_metaG |
| Project/Study | PRJEB41323 | HoloFood Chicken Caecum Metagenome – deeply sequenced batch |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA14095990