HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA13604574: SC09.16C1a

Sample data for SAMEA13604574, a HoloFood metagenomic-assembly salmon sample


Sample details
Animal
Salmon SAMEA112948738
Sample type
Metagenomic / metatranscriptomic data icon metagenomic-assembly
API endpoint
/api/samples/SAMEA13604574 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA13604574, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA13604574 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:22:31Z None
INSDC last update 2023-03-22T12:22:31Z None
INSDC status public None
SRA accession ERS11206750 None
Submitter Id SC09_16C1a_metaG None
adapters AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT None
collection date 2021-06-30 None
common name fish gut metagenome None
description Salmon metagenomic data from Distal gut content; animal SC09.16 from tank SC09 with treatment Spurv None
geographic location (country and/or sea) Norway None
geographic location (latitude) 66.08 DD
geographic location (longitude) 12.588 DD
geographic location (region and locality) Dønna; Nordland county None
host body site Distal gut content None
host common name Atlantic salmon None
host diet Ensilaged blue mussel protein None
host diet treatment Spurv: SC Ensilaged blue mussel 10.0% None
host diet treatment concentration 10 % mass
host disease status Wounded:- None
host gutted mass 36 g
host length 14.5 cm
host scientific name Salmo salar None
host storage container LetSea Tank: Spurv None
host storage container pH 7.05 None
host storage container temperature 12.76 °C
host subject id SC09.16 None
host taxid 8030 None
host total mass 43 g
library name Plant and Animal Whole Genome library (350bp) None
library selection size fractionation None
nucleic acid extraction D-rex protocol None
organism fish gut metagenome None
project HoloFood None
project name HoloFood Salmon - Trial C Metagenome None
reference host genome for decontamination GCA_000000000.0 None
sample storage buffer Shield None
sample storage container 2ml E-matrix None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name fish gut metagenome None
sequencing method Illumina Novaseq 6000 None
title SC09.16C1a None
trial timepoint 77 day

Sample metadata

Marker Measurement Units
Body site distal gut content None
Experiment metagenomics None
Organism Salmon None
Project HoloFood None
Sample code SC09.16C1a None

Treatment metadata

Marker Measurement Units
Treatment code Spurv None
Treatment concentration 10.0% %
Treatment description Ensilaged blue mussel protein None

Trial metadata

Marker Measurement Units
Environment Tanks (flow-through) None
Trial code SC None
Trial description Trial C: Blue mussel ensilage-dose response None
Trial end 2021-05-27 None
Trial start 2021-03-09 None
Metagenomics

Sample SAMEA13604574 may have been analysed by MGnify. Lookup sample on MGnify

Analyses

Analysis accession Run/assembly accession MGnify pipeline version Experiment type Detail
MGYA00617377 ERZ13633675 5.0 assembly View on MGnify
Nucleotide sequencing data

Sample SAMEA13604574 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 26,092,566bp sequenced by 174,544 reads. View sample SAMEA13604574 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA13604574 SC09.16C1a
Reads (Run) ERR9360704 webin-reads-SC09_16C1a_metaG
Reads (Experiment) ERX8902638 Illumina NovaSeq 6000 sequencing: Raw reads: SC09_16C1a_metaG
Project/Study PRJEB51815 HoloFood Salmon Trial C Gut Metagenome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13604574