marker__name	marker__type	marker__canonical_url	measurement	units
ENA-CHECKLIST	ENA Checklist		ERC000052	
ENA-FIRST-PUBLIC	ENA Checklist		2023-03-22	
ENA-LAST-UPDATE	ENA Checklist		2023-03-22	
External Id	ENA Checklist		SAMEA13604574	
INSDC center alias	ENA Checklist		UNIVERSITY OF COPENHAGEN	
INSDC center name	ENA Checklist		UNIVERSITY OF COPENHAGEN	
INSDC first public	ENA Checklist		2023-03-22T12:22:31Z	
INSDC last update	ENA Checklist		2023-03-22T12:22:31Z	
INSDC status	ENA Checklist		public	
SRA accession	ENA Checklist		ERS11206750	
Submitter Id	ENA Checklist		SC09_16C1a_metaG	
adapters	ENA Checklist		AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT	
collection date	ENA Checklist		2021-06-30	
common name	ENA Checklist		fish gut metagenome	
description	ENA Checklist		Salmon metagenomic data from Distal gut content; animal SC09.16 from tank SC09 with treatment Spurv	
geographic location (country and/or sea)	ENA Checklist		Norway	
geographic location (latitude)	ENA Checklist		66.079905	DD
geographic location (longitude)	ENA Checklist		12.587848	DD
geographic location (region and locality)	ENA Checklist		Dønna; Nordland county	
host body site	ENA Checklist		Distal gut content	
host common name	ENA Checklist		Atlantic salmon	
host diet	ENA Checklist		Ensilaged blue mussel protein	
host diet treatment	ENA Checklist		Spurv: SC Ensilaged blue mussel 10.0%	
host diet treatment concentration	ENA Checklist		10.0	% mass
host disease status	ENA Checklist		Wounded:-	
host gutted mass	ENA Checklist		36	g
host length	ENA Checklist		14.5	cm
host scientific name	ENA Checklist		Salmo salar	
host storage container	ENA Checklist		LetSea Tank: Spurv	
host storage container pH	ENA Checklist		7.05	
host storage container temperature	ENA Checklist		12.76	°C
host subject id	ENA Checklist		SC09.16	
host taxid	ENA Checklist		8030	
host total mass	ENA Checklist		43	g
library name	ENA Checklist		Plant and Animal Whole Genome library (350bp)	
library selection	ENA Checklist		size fractionation	
nucleic acid extraction	ENA Checklist		D-rex protocol	
organism	ENA Checklist		fish gut metagenome	
project	ENA Checklist		HoloFood	
project name	ENA Checklist		HoloFood Salmon - Trial C Metagenome	
reference host genome for decontamination	ENA Checklist		GCA_000000000.0	
sample storage buffer	ENA Checklist		Shield	
sample storage container	ENA Checklist		2ml E-matrix	
sample storage location	ENA Checklist		UCPH	
sample storage temperature	ENA Checklist		-20	°C
sample volume or weight for DNA extraction	ENA Checklist		0.2	mL
scientific_name	ENA Checklist		fish gut metagenome	
sequencing method	ENA Checklist		Illumina Novaseq 6000	
title	ENA Checklist		SC09.16C1a	
trial timepoint	ENA Checklist		77	day
Body site	SAMPLE		distal gut content	
Experiment	SAMPLE		metagenomics	
Organism	SAMPLE		Salmon	
Project	SAMPLE		HoloFood	
Sample code	SAMPLE		SC09.16C1a	
Treatment code	TREATMENT		Spurv	
Treatment concentration	TREATMENT		10.0%	%
Treatment description	TREATMENT		Ensilaged blue mussel protein	
Environment	TRIAL		Tanks (flow-through)	
Trial code	TRIAL		SC	
Trial description	TRIAL		Trial C: Blue mussel ensilage-dose response	
Trial end	TRIAL		2021-05-27	
Trial start	TRIAL		2021-03-09	
