No analyses found in MGnify
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA13604506, a HoloFood metagenomic-assembly salmon sample
Metadata for sample SAMEA13604506, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units | 
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None | 
| ENA-FIRST-PUBLIC | 2023-03-22 | None | 
| ENA-LAST-UPDATE | 2023-03-22 | None | 
| External Id | SAMEA13604506 | None | 
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None | 
| INSDC center name | UNIVERSITY OF COPENHAGEN | None | 
| INSDC first public | 2023-03-22T12:22:31Z | None | 
| INSDC last update | 2023-03-22T12:22:31Z | None | 
| INSDC status | public | None | 
| SRA accession | ERS11206682 | None | 
| Submitter Id | SC04_02C1a_metaG | None | 
| adapters | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | None | 
| collection date | 2021-03-10 | None | 
| common name | fish gut metagenome | None | 
| description | Salmon metagenomic data from Distal gut content; animal SC04.02 from tank SC04 with treatment Spurv | None | 
| geographic location (country and/or sea) | Norway | None | 
| geographic location (latitude) | 66.08 | DD | 
| geographic location (longitude) | 12.588 | DD | 
| geographic location (region and locality) | Dønna; Nordland county | None | 
| host body site | Distal gut content | None | 
| host common name | Atlantic salmon | None | 
| host diet | Ensilaged blue mussel protein | None | 
| host diet treatment | Spurv: SC Ensilaged blue mussel 10.0% | None | 
| host diet treatment concentration | 0 | % mass | 
| host disease status | Wounded:- | None | 
| host gutted mass | 13 | g | 
| host length | 10.6 | cm | 
| host scientific name | Salmo salar | None | 
| host storage container | LetSea Tank: Spurv | None | 
| host storage container pH | 7.05 | None | 
| host storage container temperature | 12.76 | °C | 
| host subject id | SC04.02 | None | 
| host taxid | 8030 | None | 
| host total mass | 16.2 | g | 
| library name | Plant and Animal Whole Genome library (350bp) | None | 
| library selection | size fractionation | None | 
| nucleic acid extraction | D-rex protocol | None | 
| organism | fish gut metagenome | None | 
| project | HoloFood | None | 
| project name | HoloFood Salmon - Trial C Metagenome | None | 
| reference host genome for decontamination | GCA_000000000.0 | None | 
| sample storage buffer | Shield | None | 
| sample storage container | 2ml E-matrix | None | 
| sample storage location | UCPH | None | 
| sample storage temperature | -20 | °C | 
| sample volume or weight for DNA extraction | 0.2 | mL | 
| scientific_name | fish gut metagenome | None | 
| sequencing method | Illumina Novaseq 6000 | None | 
| title | SC04.02C1a | None | 
| trial timepoint | 0 | day | 
| Marker | Measurement | Units | 
|---|---|---|
| Body site | distal gut content | None | 
| Experiment | metagenomics | None | 
| Organism | Salmon | None | 
| Project | HoloFood | None | 
| Sample code | SC04.02C1a | None | 
| Marker | Measurement | Units | 
|---|---|---|
| Treatment code | Spurv | None | 
| Treatment concentration | 10.0% | % | 
| Treatment description | Ensilaged blue mussel protein | None | 
| Marker | Measurement | Units | 
|---|---|---|
| Environment | Tanks (flow-through) | None | 
| Trial code | SC | None | 
| Trial description | Trial C: Blue mussel ensilage-dose response | None | 
| Trial end | 2021-05-27 | None | 
| Trial start | 2021-03-09 | None | 
Sample SAMEA13604506 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail | 
|---|
No analyses found in MGnify
Sample SAMEA13604506 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 4,353,732bp sequenced by 29,574 reads. View sample SAMEA13604506 in ENA
| Data domain | Accession | Title/alias | 
|---|---|---|
| Sample | SAMEA13604506 | SC04.02C1a | 
| Reads (Run) | ERR9358531 | webin-reads-SC04_02C1a_metaG | 
| Reads (Experiment) | ERX8900433 | Illumina NovaSeq 6000 sequencing: Raw reads: SC04_02C1a_metaG | 
| Project/Study | PRJEB51815 | HoloFood Salmon Trial C Gut Metagenome | 
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13604506