marker__name marker__type marker__canonical_url measurement units ENA-CHECKLIST ENA Checklist ERC000052 ENA-FIRST-PUBLIC ENA Checklist 2023-03-22 ENA-LAST-UPDATE ENA Checklist 2023-03-22 External Id ENA Checklist SAMEA13604506 INSDC center alias ENA Checklist UNIVERSITY OF COPENHAGEN INSDC center name ENA Checklist UNIVERSITY OF COPENHAGEN INSDC first public ENA Checklist 2023-03-22T12:22:31Z INSDC last update ENA Checklist 2023-03-22T12:22:31Z INSDC status ENA Checklist public SRA accession ENA Checklist ERS11206682 Submitter Id ENA Checklist SC04_02C1a_metaG adapters ENA Checklist AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT collection date ENA Checklist 2021-03-10 common name ENA Checklist fish gut metagenome description ENA Checklist Salmon metagenomic data from Distal gut content; animal SC04.02 from tank SC04 with treatment Spurv geographic location (country and/or sea) ENA Checklist Norway geographic location (latitude) ENA Checklist 66.079905 DD geographic location (longitude) ENA Checklist 12.587848 DD geographic location (region and locality) ENA Checklist Dønna; Nordland county host body site ENA Checklist Distal gut content host common name ENA Checklist Atlantic salmon host diet ENA Checklist Ensilaged blue mussel protein host diet treatment ENA Checklist Spurv: SC Ensilaged blue mussel 10.0% host diet treatment concentration ENA Checklist 0 % mass host disease status ENA Checklist Wounded:- host gutted mass ENA Checklist 13 g host length ENA Checklist 10.6 cm host scientific name ENA Checklist Salmo salar host storage container ENA Checklist LetSea Tank: Spurv host storage container pH ENA Checklist 7.05 host storage container temperature ENA Checklist 12.76 °C host subject id ENA Checklist SC04.02 host taxid ENA Checklist 8030 host total mass ENA Checklist 16.2 g library name ENA Checklist Plant and Animal Whole Genome library (350bp) library selection ENA Checklist size fractionation nucleic acid extraction ENA Checklist D-rex protocol organism ENA Checklist fish gut metagenome project ENA Checklist HoloFood project name ENA Checklist HoloFood Salmon - Trial C Metagenome reference host genome for decontamination ENA Checklist GCA_000000000.0 sample storage buffer ENA Checklist Shield sample storage container ENA Checklist 2ml E-matrix sample storage location ENA Checklist UCPH sample storage temperature ENA Checklist -20 °C sample volume or weight for DNA extraction ENA Checklist 0.2 mL scientific_name ENA Checklist fish gut metagenome sequencing method ENA Checklist Illumina Novaseq 6000 title ENA Checklist SC04.02C1a trial timepoint ENA Checklist 0 day Body site SAMPLE distal gut content Experiment SAMPLE metagenomics Organism SAMPLE Salmon Project SAMPLE HoloFood Sample code SAMPLE SC04.02C1a Treatment code TREATMENT Spurv Treatment concentration TREATMENT 10.0% % Treatment description TREATMENT Ensilaged blue mussel protein Environment TRIAL Tanks (flow-through) Trial code TRIAL SC Trial description TRIAL Trial C: Blue mussel ensilage-dose response Trial end TRIAL 2021-05-27 Trial start TRIAL 2021-03-09