HoloFood Data Portal
Access samples and data collected and generated by the HoloFood project.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA13389373, a HoloFood host-genomic chicken sample
Metadata for sample SAMEA13389373, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-03-22 | None |
| ENA-LAST-UPDATE | 2023-03-22 | None |
| External Id | SAMEA13389373 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-03-22T12:22:26Z | None |
| INSDC last update | 2023-03-22T12:22:26Z | None |
| INSDC status | public | None |
| SRA accession | ERS10991870 | None |
| Submitter Id | CB08_08F1a_MAGCC_HostG | None |
| adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC | None |
| collection date | 2019-05-20 | None |
| common name | chicken | None |
| description | Chicken host genomic data from Caecum content; animal CB08.08 from cage CB08 with treatment CO | None |
| geographic location (country and/or sea) | Spain | None |
| geographic location (latitude) | 41.17 | DD |
| geographic location (longitude) | 1.1685 | DD |
| geographic location (region and locality) | El Morell; Tarragona | None |
| host body site | Caecum content | None |
| host breed | Cobb | None |
| host common name | Chicken | None |
| host diet treatment | Probiotic | None |
| host disease status | Campylobacter:-;Salmonella:-;Clostridium:- | None |
| host scientific name | Gallus gallus | None |
| host sex | male | None |
| host storage container temperature | 21 | °C |
| host subject id | CB08.08 | None |
| host taxid | 9031 | None |
| host total mass | 973.8 | g |
| library name | BEMT | None |
| library selection | PCR | None |
| nucleic acid extraction | D-rex protocol | None |
| organism | Gallus gallus | None |
| project | HoloFood | None |
| project name | HoloFood Chicken - Host Genome | None |
| reference host genome for decontamination | GCF_000002315.6 | None |
| sample storage buffer | Shield | None |
| sample storage container | E-matrix 2ml | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | Gallus gallus | None |
| sequencing method | MGISEQ-2000 | None |
| title | CB08.08F1a_HostG | None |
| trial length | 35 | day |
| trial timepoint | 21 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | caecum content | None |
| Experiment | genomics | None |
| Index PCR cycles | 9 | None |
| Lab Process ID | LPC00324 | None |
| Organism | Chicken | None |
| Pool | MAG02-528 | None |
| Project | HoloFood | None |
| Raw sequence name | F19FTSEUET0172_MICshtR/MAG02/200219_I076_V300042185_L2_CDK153B200218002-528/V300042185_L02_528 | None |
| Sample code | CB08.08F1a | None |
| Sequencing company | BGI | None |
| ng used for library build | 393.3 | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | CO | None |
| Treatment name | Probiotic | None |
| Marker | Measurement | Units |
|---|---|---|
| Trial code | CB | None |
| Trial description | Trial 2 | None |
| Trial end | 2019-05-19 | None |
| Trial start | 2019-04-21 | None |
Sample SAMEA13389373 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 4,747,171,180bp sequenced by 32,521,922 reads. View sample SAMEA13389373 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA13389373 | CB08.08F1a_HostG |
| Reads (Run) | ERR9286239 | webin-reads-CB08_08F1a_MAGCC_HostG |
| Reads (Experiment) | ERX8828344 | DNBSEQ-G400 sequencing: Raw reads: CB08_08F1a_MAGCC_HostG |
| Project/Study | PRJEB45273 | HoloFood Chicken Host Genome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13389373
