HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA13389299: CB01.05F1a_HostG

Sample data for SAMEA13389299, a HoloFood host-genomic chicken sample


Sample details
Animal
Chicken SAMEA112905350
Sample type
Host genome data icon host-genomic
API endpoint
/api/samples/SAMEA13389299 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA13389299, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA13389299 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:22:28Z None
INSDC last update 2023-03-22T12:22:28Z None
INSDC status public None
SRA accession ERS10991796 None
Submitter Id CB01_05F1a_MAGCC_HostG None
adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC None
collection date 2019-05-07 None
common name chicken None
description Chicken host genomic data from Caecum content; animal CB01.05 from cage CB01 with treatment CE None
geographic location (country and/or sea) Spain None
geographic location (latitude) 41.17 DD
geographic location (longitude) 1.1685 DD
geographic location (region and locality) El Morell; Tarragona None
host body site Caecum content None
host breed Cobb None
host common name Chicken None
host diet treatment Prebiotic None
host disease status Campylobacter:-;Salmonella:-;Clostridium:- None
host scientific name Gallus gallus None
host sex female None
host storage container temperature 21 °C
host subject id CB01.05 None
host taxid 9031 None
host total mass 230.3 g
library name BEMT None
library selection PCR None
nucleic acid extraction D-rex protocol None
organism Gallus gallus None
project HoloFood None
project name HoloFood Chicken - Host Genome None
reference host genome for decontamination GCF_000002315.6 None
sample storage buffer Shield None
sample storage container E-matrix 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name Gallus gallus None
sequencing method MGISEQ-2000 None
title CB01.05F1a_HostG None
trial length 35 day
trial timepoint 7 day

Sample metadata

Marker Measurement Units
Body site caecum content None
Experiment genomics None
Index PCR cycles 12 None
Lab Process ID LPC00253 None
Organism Chicken None
Pool MAG11-519 None
Project HoloFood None
Raw sequence name F20FTSEUET0036_MICrpnR/MAG11/200310_I001_V300038517_L2_CDK153B200227002-519/V300038517_L02_519 None
Sample code CB01.05F1a None
Sequencing company BGI None
ng used for library build 384 None

Treatment metadata

Marker Measurement Units
Treatment code CE None
Treatment name Prebiotic None

Trial metadata

Marker Measurement Units
Trial code CB None
Trial description Trial 2 None
Trial end 2019-05-19 None
Trial start 2019-04-21 None
Nucleotide sequencing data

Sample SAMEA13389299 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 10,243,922,003bp sequenced by 71,331,342 reads. View sample SAMEA13389299 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA13389299 CB01.05F1a_HostG
Reads (Run) ERR9286277 webin-reads-CB01_05F1a_MAGCC_HostG
Reads (Experiment) ERX8828382 DNBSEQ-G400 sequencing: Raw reads: CB01_05F1a_MAGCC_HostG
Project/Study PRJEB45273 HoloFood Chicken Host Genome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13389299