Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA10130004, a HoloFood metagenomic-assembly chicken sample
Metadata for sample SAMEA10130004, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units | 
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None | 
| ENA-FIRST-PUBLIC | 2023-03-22 | None | 
| ENA-LAST-UPDATE | 2023-03-22 | None | 
| External Id | SAMEA10130004 | None | 
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None | 
| INSDC center name | UNIVERSITY OF COPENHAGEN | None | 
| INSDC first public | 2023-03-22T12:21:56Z | None | 
| INSDC last update | 2023-03-22T12:21:56Z | None | 
| INSDC status | public | None | 
| SRA accession | ERS7786531 | None | 
| Submitter Id | CA21_01C1a_metaG | None | 
| adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC | None | 
| collection date | 2019-02-11 | None | 
| common name | Chicken Gut Metagenome | None | 
| description | Chicken gut metagenomic data from Ileum content; animal CA21.01 from cage CA21 with treatment CE | None | 
| geographic location (country and/or sea) | Spain | None | 
| geographic location (latitude) | 41.17 | DD | 
| geographic location (longitude) | 1.1685 | DD | 
| geographic location (region and locality) | El Morell; Tarragona | None | 
| host body site | Ileum content | None | 
| host breed | Ross | None | 
| host common name | Chicken | None | 
| host diet treatment | Prebiotic | None | 
| host disease status | Campylobacter:-;Salmonella:-;Clostridium:- | None | 
| host scientific name | Gallus gallus | None | 
| host sex | male | None | 
| host storage container temperature | 21 | °C | 
| host subject id | CA21.01 | None | 
| host taxid | 9031 | None | 
| host total mass | 219.2 | g | 
| library name | BEMT | None | 
| library selection | PCR | None | 
| nucleic acid extraction | D-rex protocol | None | 
| organism | chicken gut metagenome | None | 
| project | HoloFood | None | 
| project name | HoloFood Chicken - Prior Chicken Ileum Content | None | 
| reference host genome for decontamination | GCF_000002315.6 | None | 
| sample storage buffer | Shield | None | 
| sample storage container | E-matrix 2ml | None | 
| sample storage location | UCPH | None | 
| sample storage temperature | -20 | °C | 
| sample volume or weight for DNA extraction | 0.2 | mL | 
| scientific_name | chicken gut metagenome | None | 
| sequencing method | MGISEQ-2000 | None | 
| title | CA21.01C1a | None | 
| trial length | 35 | day | 
| trial timepoint | 7 | day | 
| Marker | Measurement | Units | 
|---|---|---|
| Body site | ileum content | None | 
| Experiment | metagenomics | None | 
| Organism | Chicken | None | 
| Project | HoloFood | None | 
| Sample code | CA21.01C1a | None | 
| Marker | Measurement | Units | 
|---|---|---|
| Treatment code | CE | None | 
| Treatment name | Prebiotic | None | 
| Marker | Measurement | Units | 
|---|---|---|
| Trial code | CA | None | 
| Trial description | Trial 1 | None | 
| Trial end | 2019-03-11 | None | 
| Trial start | 2019-02-04 | None | 
Sample SAMEA10130004 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail | 
|---|---|---|---|---|
| MGYA00606585 | ERR6769783 | 5.0 | metagenomic | View on MGnify | 
| MGYA00617108 | ERZ11806395 | 5.0 | assembly | View on MGnify | 
Sample SAMEA10130004 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 233,012,061bp sequenced by 1,671,330 reads. View sample SAMEA10130004 in ENA
| Data domain | Accession | Title/alias | 
|---|---|---|
| Sample | SAMEA10130004 | CA21.01C1a | 
| Reads (Run) | ERR6769783 | webin-reads-CA21_01C1a_metaG | 
| Reads (Experiment) | ERX6393565 | DNBSEQ-G400 sequencing: Raw reads: CA21_01C1a_metaG | 
| Project/Study | PRJEB47609 | HoloFood Chicken Ileum Metagenome – deeply sequenced batch | 
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA10130004