No analyses found in MGnify
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA10105020, a HoloFood metagenomic-assembly chicken sample
Metadata for sample SAMEA10105020, stored in BioSamples and ENA.
Download all as TSVMarker | Measurement | Units |
---|---|---|
ENA-CHECKLIST | ERC000052 | None |
ENA-FIRST-PUBLIC | 2023-03-22 | None |
ENA-LAST-UPDATE | 2023-03-22 | None |
External Id | SAMEA10105020 | None |
INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
INSDC center name | UNIVERSITY OF COPENHAGEN | None |
INSDC first public | 2023-03-22T12:21:55Z | None |
INSDC last update | 2023-03-22T12:21:55Z | None |
INSDC status | public | None |
SRA accession | ERS7761649 | None |
Submitter Id | CC04_03F1a_EC_metaG | None |
adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC | None |
collection date | 2019-09-16 | None |
common name | Chicken Gut Metagenome | None |
description | Chicken gut metagenomic data from Caecum content; animal CC04.03 from cage CC04 with treatment CO | None |
geographic location (country and/or sea) | Spain | None |
geographic location (latitude) | 41.17 | DD |
geographic location (longitude) | 1.1685 | DD |
geographic location (region and locality) | El Morell; Tarragona | None |
host body site | Caecum content | None |
host breed | Ross | None |
host common name | Chicken | None |
host diet treatment | Probiotic | None |
host disease status | Campylobacter:-;Salmonella:-;Clostridium:- | None |
host scientific name | Gallus gallus | None |
host sex | female | None |
host storage container temperature | 21 | °C |
host subject id | CC04.03 | None |
host taxid | 9031 | None |
host total mass | 155.2 | g |
library name | BEMT | None |
library selection | PCR | None |
nucleic acid extraction | D-rex protocol | None |
organism | chicken gut metagenome | None |
project | HoloFood | None |
project name | HoloFood Chicken - Extreme Chicken | None |
reference host genome for decontamination | GCF_000002315.6 | None |
sample storage buffer | Shield | None |
sample storage container | E-matrix 2ml | None |
sample storage location | UCPH | None |
sample storage temperature | -20 | °C |
sample volume or weight for DNA extraction | 0.2 | mL |
scientific_name | chicken gut metagenome | None |
sequencing method | MGISEQ-2000 | None |
title | CC04.03F1a | None |
trial length | 35 | day |
trial timepoint | 7 | day |
Marker | Measurement | Units |
---|---|---|
Body site | caecum content | None |
Experiment | metagenomics | None |
Organism | Chicken | None |
Project | HoloFood | None |
Sample code | CC04.03F1a | None |
Marker | Measurement | Units |
---|---|---|
Treatment code | CO | None |
Treatment name | Probiotic | None |
Marker | Measurement | Units |
---|---|---|
Trial code | CC | None |
Trial description | Trial 3 | None |
Trial end | 2019-07-14 | None |
Trial start | 2019-06-09 | None |
Sample SAMEA10105020 may have been analysed by MGnify. Lookup sample on MGnify
Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
---|
No analyses found in MGnify
Sample SAMEA10105020 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 5,815,579,095bp sequenced by 39,974,920 reads. View sample SAMEA10105020 in ENA
Data domain | Accession | Title/alias |
---|---|---|
Sample | SAMEA10105020 | CC04.03F1a |
Reads (Run) | ERR6748748 | webin-reads-CC04_03F1a_EC_metaG |
Reads (Experiment) | ERX6372696 | DNBSEQ-G400 sequencing: Raw reads: CC04_03F1a_EC_metaG |
Project/Study | PRJEB46550 | HoloFood Chicken Caecum Metagenome – extreme sizes batch |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA10105020