Could not connect to MGnify right now. Please try later.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA9449915, a HoloFood metagenomic-assembly chicken sample
Metadata for sample SAMEA9449915, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-03-22 | None |
| ENA-LAST-UPDATE | 2023-03-22 | None |
| External Id | SAMEA9449915 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-03-22T12:21:48Z | None |
| INSDC last update | 2023-03-22T12:21:48Z | None |
| INSDC status | public | None |
| SRA accession | ERS7173098 | None |
| Submitter Id | CC01_07F1a_metaG | None |
| adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC | None |
| collection date | 2019-09-30 | None |
| common name | Chicken Gut Metagenome | None |
| description | Chicken gut metagenomic data from Caecum content; animal CC01.07 from cage CC01 with treatment CO | None |
| geographic location (country and/or sea) | Spain | None |
| geographic location (latitude) | 41.17 | DD |
| geographic location (longitude) | 1.1685 | DD |
| geographic location (region and locality) | El Morell; Tarragona | None |
| host body site | Caecum content | None |
| host breed | Cobb | None |
| host common name | Chicken | None |
| host diet treatment | Probiotic | None |
| host disease status | Campylobacter:+;Salmonella:-;Clostridium:- | None |
| host scientific name | Gallus gallus | None |
| host sex | male | None |
| host storage container temperature | 21 | °C |
| host subject id | CC01.07 | None |
| host taxid | 9031 | None |
| host total mass | 1092 | g |
| library name | BEMT | None |
| library selection | PCR | None |
| nucleic acid extraction | D-rex protocol | None |
| organism | chicken gut metagenome | None |
| project | HoloFood | None |
| project name | HoloFood Chicken - Extreme Chicken | None |
| reference host genome for decontamination | GCF_000002315.6 | None |
| sample storage buffer | Shield | None |
| sample storage container | E-matrix 2ml | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | chicken gut metagenome | None |
| sequencing method | MGISEQ-2000 | None |
| title | CC01.07F1a | None |
| trial length | 35 | day |
| trial timepoint | 21 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | caecum content | None |
| Experiment | metagenomics | None |
| Organism | Chicken | None |
| Project | HoloFood | None |
| Sample code | CC01.07F1a | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | CO | None |
| Treatment name | Probiotic | None |
| Marker | Measurement | Units |
|---|---|---|
| Trial code | CC | None |
| Trial description | Trial 3 | None |
| Trial end | 2019-07-14 | None |
| Trial start | 2019-06-09 | None |
Sample SAMEA9449915 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
|---|
No analyses found in MGnify
Sample SAMEA9449915 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 6,599,422,916bp sequenced by 45,256,636 reads. View sample SAMEA9449915 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA9449915 | CC01.07F1a |
| Reads (Run) | ERR6354696 | webin-reads-CC01_07F1a_metaG |
| Reads (Experiment) | ERX5986271 | DNBSEQ-G400 sequencing: Raw reads: CC01_07F1a_metaG |
| Project/Study | PRJEB46550 | HoloFood Chicken Caecum Metagenome – extreme sizes batch |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA9449915