Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA9097960, a HoloFood host-genomic chicken sample
Metadata for sample SAMEA9097960, stored in BioSamples and ENA.
Download all as TSVMarker | Measurement | Units |
---|---|---|
ENA-CHECKLIST | ERC000052 | None |
ENA-FIRST-PUBLIC | 2023-03-22 | None |
ENA-LAST-UPDATE | 2023-03-22 | None |
External Id | SAMEA9097960 | None |
INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
INSDC center name | UNIVERSITY OF COPENHAGEN | None |
INSDC first public | 2023-03-22T12:21:43Z | None |
INSDC last update | 2023-03-22T12:21:43Z | None |
INSDC status | public | None |
SRA accession | ERS6824091 | None |
Submitter Id | CC11_15C1a_hostG | None |
adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT | None |
collection date | 2019-10-15 | None |
common name | chicken | None |
description | Chicken host genomic data from Ileum content; animal CC11.15 from cage CC11 with treatment CC | None |
geographic location (country and/or sea) | Spain | None |
geographic location (latitude) | 41.17 | DD |
geographic location (longitude) | 1.1685 | DD |
geographic location (region and locality) | El Morell; Tarragona | None |
host body site | Ileum content | None |
host breed | Cobb | None |
host common name | Chicken | None |
host diet treatment | Control | None |
host disease status | Campylobacter:+;Salmonella:-;Clostridium:- | None |
host scientific name | Gallus gallus | None |
host sex | female | None |
host storage container temperature | 21 | °C |
host subject id | CC11.15 | None |
host taxid | 9031 | None |
host total mass | 2114 | g |
library name | BEST | None |
library selection | PCR | None |
nucleic acid extraction | D-rex protocol | None |
organism | Gallus gallus | None |
project | HoloFood | None |
project name | HoloFood Chicken - Host Genome | None |
reference host genome for decontamination | GCF_000002315.6 | None |
sample storage buffer | Shield | None |
sample storage container | E-matrix 2ml | None |
sample storage location | UCPH | None |
sample storage temperature | -20 | °C |
sample volume or weight for DNA extraction | 0.2 | mL |
scientific_name | Gallus gallus | None |
sequencing method | MGISEQ-2000 | None |
title | CC11.15C1a | None |
trial length | 35 | day |
trial timepoint | 35 | day |
Marker | Measurement | Units |
---|---|---|
Body site | ileum content | None |
Experiment | genomics | None |
Index PCR cycles | 6 | None |
Lab Process ID | LPC00210 | None |
Organism | Chicken | None |
Pool | IC-MAG-14-532 | None |
Project | HoloFood | None |
Raw sequence name | F20FTSEUHT1189_GALvxbR/IC-MAG-14/DKBSP03472/201212_I095_V300074418_L3_CDK153B201127002-532/V300074418_L03 | None |
Sample code | CC11.15C1a | None |
Sequencing company | BGI | None |
ng used for library build | 34.6 | None |
Marker | Measurement | Units |
---|---|---|
Treatment code | CC | None |
Treatment name | Control | None |
Marker | Measurement | Units |
---|---|---|
Trial code | CC | None |
Trial description | Trial 3 | None |
Trial end | 2019-07-14 | None |
Trial start | 2019-06-09 | None |
Sample SAMEA9097960 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 82,103,444,448bp sequenced by 583,385,906 reads. View sample SAMEA9097960 in ENA
Data domain | Accession | Title/alias |
---|---|---|
Sample | SAMEA9097960 | CC11.15C1a |
Reads (Run) | ERR6149961 | webin-reads-CC11_15C1a_hostG |
Reads (Experiment) | ERX5786785 | DNBSEQ-G400 sequencing: Raw reads: CC11_15C1a_hostG |
Project/Study | PRJEB45273 | HoloFood Chicken Host Genome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA9097960