HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA9069015: SB12.05C1a

Sample data for SAMEA9069015, a HoloFood host-genomic salmon sample


Sample details
Animal
Salmon SAMEA112949165
Sample type
Host genome data icon host-genomic
API endpoint
/api/samples/SAMEA9069015 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA9069015, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA9069015 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:21:42Z None
INSDC last update 2023-03-22T12:21:42Z None
INSDC status public None
SRA accession ERS6797330 None
Submitter Id SB12_05C1a_hostG None
adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT None
collection date 2019-08-14 None
common name Atlantic salmon None
description Salmon host genomic data from Distal gut content; animal SB12.05 from tank SB12 with treatment Venus None
geographic location (country and/or sea) Norway None
geographic location (latitude) 66.08 DD
geographic location (longitude) 12.588 DD
geographic location (region and locality) Dønna; Nordland county None
host body site Distal gut content None
host common name Atlantic salmon None
host diet Sanford Blue Mussel Meal None
host diet treatment Venus: SB 8.7% blue mussel meal None
host diet treatment concentration 0 % mass
host disease status Wounded:- None
host gutted mass 176.6 g
host length 28 cm
host scientific name Salmo salar None
host storage container LetSea Tank: Venus None
host storage container pH 7.05 None
host storage container temperature 12.76 °C
host subject id SB12.05 None
host taxid 8030 None
host total mass 203.6 g
library name BEST None
library selection PCR None
nucleic acid extraction D-rex protocol None
organism Salmo salar None
project HoloFood None
project name HoloFood Salmon - Host Genome None
reference host genome for decontamination GCA_000000000.0 None
sample storage buffer Shield None
sample storage container 2ml E-matrix None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name Salmo salar None
sequencing method MGISEQ-2000 None
title SB12.05C1a None
trial timepoint 0 day

Sample metadata

Marker Measurement Units
Body site distal gut content None
Experiment genomics None
Index PCR cycles 12 None
Lab Process ID LPS00536 None
Omics Metagenomics None
Organism Salmon None
Pool S-MG-P43-501 None
Project HoloFood None
Raw seq. name S-MG-P43-501/V300074262_L03_501 None
Sample code SB12.05C1a None
Sequencing company BGI None

Treatment metadata

Marker Measurement Units
Treatment code Venus None
Treatment concentration 8.7% %
Treatment description Sanford Blue Mussel Meal None

Trial metadata

Marker Measurement Units
Environment Tanks (flow-through) None
Trial code SB None
Trial description Trial B: Blue mussel-dose response None
Trial end 2019-11-22 None
Trial start 2019-08-14 None
Nucleotide sequencing data

Sample SAMEA9069015 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 7,756,884,001bp sequenced by 53,280,038 reads. View sample SAMEA9069015 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA9069015 SB12.05C1a
Reads (Run) ERR5988906 webin-reads-SB12_05C1a_hostG
Reads (Experiment) ERX5629670 DNBSEQ-G400 sequencing: Raw reads: SB12_05C1a_hostG
Project/Study PRJEB45274 HoloFood Salmon Host Genome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA9069015