Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA9068995, a HoloFood host-genomic salmon sample
Metadata for sample SAMEA9068995, stored in BioSamples and ENA.
Download all as TSVMarker | Measurement | Units |
---|---|---|
ENA-CHECKLIST | ERC000052 | None |
ENA-FIRST-PUBLIC | 2023-03-22 | None |
ENA-LAST-UPDATE | 2023-03-22 | None |
External Id | SAMEA9068995 | None |
INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
INSDC center name | UNIVERSITY OF COPENHAGEN | None |
INSDC first public | 2023-03-22T12:21:43Z | None |
INSDC last update | 2023-03-22T12:21:43Z | None |
INSDC status | public | None |
SRA accession | ERS6797310 | None |
Submitter Id | SB11_15C1a_hostG | None |
adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT | None |
collection date | 2019-10-14 | None |
common name | Atlantic salmon | None |
description | Salmon host genomic data from Distal gut content; animal SB11.15 from tank SB11 with treatment Mars | None |
geographic location (country and/or sea) | Norway | None |
geographic location (latitude) | 66.08 | DD |
geographic location (longitude) | 12.588 | DD |
geographic location (region and locality) | Dønna; Nordland county | None |
host body site | Distal gut content | None |
host common name | Atlantic salmon | None |
host diet | Sanford Blue Mussel Meal | None |
host diet treatment | Mars: SB Control | None |
host diet treatment concentration | 0 | % mass |
host disease status | Wounded:- | None |
host gutted mass | 428.6 | g |
host length | 33.8 | cm |
host scientific name | Salmo salar | None |
host storage container | LetSea Tank: Mars | None |
host storage container pH | 7.05 | None |
host storage container temperature | 12.76 | °C |
host subject id | SB11.15 | None |
host taxid | 8030 | None |
host total mass | 500.6 | g |
library name | BEST | None |
library selection | PCR | None |
nucleic acid extraction | D-rex protocol | None |
organism | Salmo salar | None |
project | HoloFood | None |
project name | HoloFood Salmon - Host Genome | None |
reference host genome for decontamination | GCA_000000000.0 | None |
sample storage buffer | Shield | None |
sample storage container | 2ml E-matrix | None |
sample storage location | UCPH | None |
sample storage temperature | -20 | °C |
sample volume or weight for DNA extraction | 0.2 | mL |
scientific_name | Salmo salar | None |
sequencing method | MGISEQ-2000 | None |
title | SB11.15C1a | None |
trial timepoint | 60 | day |
Marker | Measurement | Units |
---|---|---|
Body site | distal gut content | None |
Experiment | genomics | None |
Index PCR cycles | 12 | None |
Lab Process ID | LPS00630 | None |
Omics | Metagenomics | None |
Organism | Salmon | None |
Pool | S-MG-P31-527 | None |
Project | HoloFood | None |
Raw seq. name | S-MG-P31-527/V300074385_L03_527 | None |
Sample code | SB11.15C1a | None |
Sequencing company | BGI | None |
Marker | Measurement | Units |
---|---|---|
Treatment code | Mars | None |
Treatment concentration | 0.0% | % |
Treatment description | Sanford Blue Mussel Meal | None |
Marker | Measurement | Units |
---|---|---|
Environment | Tanks (flow-through) | None |
Trial code | SB | None |
Trial description | Trial B: Blue mussel-dose response | None |
Trial end | 2019-11-22 | None |
Trial start | 2019-08-14 | None |
Sample SAMEA9068995 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 6,980,741,390bp sequenced by 48,608,126 reads. View sample SAMEA9068995 in ENA
Data domain | Accession | Title/alias |
---|---|---|
Sample | SAMEA9068995 | SB11.15C1a |
Reads (Run) | ERR5987791 | webin-reads-SB11_15C1a_hostG |
Reads (Experiment) | ERX5628554 | DNBSEQ-G400 sequencing: Raw reads: SB11_15C1a_hostG |
Project/Study | PRJEB45274 | HoloFood Salmon Host Genome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA9068995