Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA9068826, a HoloFood host-genomic salmon sample
Metadata for sample SAMEA9068826, stored in BioSamples and ENA.
Download all as TSVMarker | Measurement | Units |
---|---|---|
ENA-CHECKLIST | ERC000052 | None |
ENA-FIRST-PUBLIC | 2023-03-22 | None |
ENA-LAST-UPDATE | 2023-03-22 | None |
External Id | SAMEA9068826 | None |
INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
INSDC center name | UNIVERSITY OF COPENHAGEN | None |
INSDC first public | 2023-03-22T12:21:42Z | None |
INSDC last update | 2023-03-22T12:21:42Z | None |
INSDC status | public | None |
SRA accession | ERS6797144 | None |
Submitter Id | SA11_29C1a_hostG | None |
adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT | None |
collection date | 2019-08-12 | None |
common name | Atlantic salmon | None |
description | Salmon host genomic data from Distal gut content; animal SA11.29 from tank SA11 with treatment Tiger | None |
geographic location (country and/or sea) | Norway | None |
geographic location (latitude) | 66.08 | DD |
geographic location (longitude) | 12.588 | DD |
geographic location (region and locality) | Dønna; Nordland county | None |
host body site | Distal gut content | None |
host common name | Atlantic salmon | None |
host diet | Fermented algae meal (added in in oil coating) | None |
host diet treatment | Tiger: SA Control | None |
host diet treatment concentration | 0 | % mass |
host disease status | Wounded:- | None |
host gutted mass | 518.2 | g |
host length | 35.5 | cm |
host scientific name | Salmo salar | None |
host storage container | LetSea Tank: Tiger | None |
host storage container pH | 7.05 | None |
host storage container temperature | 12.76 | °C |
host subject id | SA11.29 | None |
host taxid | 8030 | None |
host total mass | 590.6 | g |
library name | BEST | None |
library selection | PCR | None |
nucleic acid extraction | D-rex protocol | None |
organism | Salmo salar | None |
project | HoloFood | None |
project name | HoloFood Salmon - Host Genome | None |
reference host genome for decontamination | GCA_000000000.0 | None |
sample storage buffer | Shield | None |
sample storage container | 2ml E-matrix | None |
sample storage location | UCPH | None |
sample storage temperature | -20 | °C |
sample volume or weight for DNA extraction | 0.2 | mL |
scientific_name | Salmo salar | None |
sequencing method | MGISEQ-2000 | None |
title | SA11.29C1a | None |
trial timepoint | 60 | day |
Marker | Measurement | Units |
---|---|---|
Body site | distal gut content | None |
Experiment | genomics | None |
Index PCR cycles | 12 | None |
Lab Process ID | LPS00605 | None |
Omics | Metagenomics | None |
Organism | Salmon | None |
Pool | S-MG-P34-528 | None |
Project | HoloFood | None |
Raw seq. name | S-MG-P34-528/V300074173_L02_528 | None |
Sample code | SA11.29C1a | None |
Sequencing company | BGI | None |
Marker | Measurement | Units |
---|---|---|
Treatment code | Tiger | None |
Treatment concentration | 0.0% | % |
Treatment description | Fermented algae meal (added in in oil coating) | None |
Marker | Measurement | Units |
---|---|---|
Environment | Tanks (flow-through) | None |
Trial code | SA | None |
Trial description | Trial A: Seaweed-dose response | None |
Trial end | 2019-08-13 | None |
Trial start | 2019-06-11 | None |
Sample SAMEA9068826 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 10,803,552,507bp sequenced by 75,076,496 reads. View sample SAMEA9068826 in ENA
Data domain | Accession | Title/alias |
---|---|---|
Sample | SAMEA9068826 | SA11.29C1a |
Reads (Run) | ERR5988739 | webin-reads-SA11_29C1a_hostG |
Reads (Experiment) | ERX5629502 | DNBSEQ-G400 sequencing: Raw reads: SA11_29C1a_hostG |
Project/Study | PRJEB45274 | HoloFood Salmon Host Genome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA9068826