HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA9068721: SA05.05C1a

Sample data for SAMEA9068721, a HoloFood host-genomic salmon sample


Sample details
Animal
Salmon SAMEA112948556
Sample type
Host genome data icon host-genomic
API endpoint
/api/samples/SAMEA9068721 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA9068721, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA9068721 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:21:41Z None
INSDC last update 2023-03-22T12:21:41Z None
INSDC status public None
SRA accession ERS6797036 None
Submitter Id SA05_05C1a_hostG None
adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT None
collection date 2019-06-11 None
common name Atlantic salmon None
description Salmon host genomic data from Distal gut content; animal SA05.05 from tank SA05 with treatment Cougar None
geographic location (country and/or sea) Norway None
geographic location (latitude) 66.08 DD
geographic location (longitude) 12.588 DD
geographic location (region and locality) Dønna; Nordland county None
host body site Distal gut content None
host common name Atlantic salmon None
host diet Fermented algae meal (added in in oil coating) None
host diet treatment Cougar: SA 1.5% seaweed None
host diet treatment concentration 0 % mass
host disease status Wounded:- None
host gutted mass 252.8 g
host length 27.5 cm
host scientific name Salmo salar None
host storage container LetSea Tank: Cougar None
host storage container pH 7.05 None
host storage container temperature 12.76 °C
host subject id SA05.05 None
host taxid 8030 None
host total mass 297 g
library name BEST None
library selection PCR None
nucleic acid extraction D-rex protocol None
organism Salmo salar None
project HoloFood None
project name HoloFood Salmon - Host Genome None
reference host genome for decontamination GCA_000000000.0 None
sample storage buffer Shield None
sample storage container 2ml E-matrix None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name Salmo salar None
sequencing method MGISEQ-2000 None
title SA05.05C1a None
trial timepoint 0 day

Sample metadata

Marker Measurement Units
Body site distal gut content None
Experiment genomics None
Index PCR cycles 12 None
Lab Process ID LPS00525 None
Omics Metagenomics None
Organism Salmon None
Pool S-MG-P44-520 None
Project HoloFood None
Raw seq. name S-MG-P44-520/V300074262_L04_520 None
Sample code SA05.05C1a None
Sequencing company BGI None

Treatment metadata

Marker Measurement Units
Treatment code Cougar None
Treatment concentration 1.5% %
Treatment description Fermented algae meal (added in in oil coating) None

Trial metadata

Marker Measurement Units
Environment Tanks (flow-through) None
Trial code SA None
Trial description Trial A: Seaweed-dose response None
Trial end 2019-08-13 None
Trial start 2019-06-11 None
Nucleotide sequencing data

Sample SAMEA9068721 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 15,126,140,504bp sequenced by 105,345,484 reads. View sample SAMEA9068721 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA9068721 SA05.05C1a
Reads (Run) ERR5987648 webin-reads-SA05_05C1a_hostG
Reads (Experiment) ERX5628415 DNBSEQ-G400 sequencing: Raw reads: SA05_05C1a_hostG
Project/Study PRJEB45274 HoloFood Salmon Host Genome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA9068721