HoloFood Data Portal
Access samples and data collected and generated by the HoloFood project.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA9068671, a HoloFood host-genomic salmon sample
Metadata for sample SAMEA9068671, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-03-22 | None |
| ENA-LAST-UPDATE | 2023-03-22 | None |
| External Id | SAMEA9068671 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-03-22T12:21:42Z | None |
| INSDC last update | 2023-03-22T12:21:42Z | None |
| INSDC status | public | None |
| SRA accession | ERS6796985 | None |
| Submitter Id | SA01_19C1a_hostG | None |
| adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT | None |
| collection date | 2019-08-12 | None |
| common name | Atlantic salmon | None |
| description | Salmon host genomic data from Distal gut content; animal SA01.19 from tank SA01 with treatment Tiger | None |
| geographic location (country and/or sea) | Norway | None |
| geographic location (latitude) | 66.08 | DD |
| geographic location (longitude) | 12.588 | DD |
| geographic location (region and locality) | Dønna; Nordland county | None |
| host body site | Distal gut content | None |
| host common name | Atlantic salmon | None |
| host diet | Fermented algae meal (added in in oil coating) | None |
| host diet treatment | Tiger: SA Control | None |
| host diet treatment concentration | 0 | % mass |
| host disease status | Wounded:- | None |
| host gutted mass | 480.6 | g |
| host length | 35 | cm |
| host scientific name | Salmo salar | None |
| host storage container | LetSea Tank: Tiger | None |
| host storage container pH | 7.05 | None |
| host storage container temperature | 12.76 | °C |
| host subject id | SA01.19 | None |
| host taxid | 8030 | None |
| host total mass | 573.4 | g |
| library name | BEST | None |
| library selection | PCR | None |
| nucleic acid extraction | D-rex protocol | None |
| organism | Salmo salar | None |
| project | HoloFood | None |
| project name | HoloFood Salmon - Host Genome | None |
| reference host genome for decontamination | GCA_000000000.0 | None |
| sample storage buffer | Shield | None |
| sample storage container | 2ml E-matrix | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | Salmo salar | None |
| sequencing method | MGISEQ-2000 | None |
| title | SA01.19C1a | None |
| trial timepoint | 60 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | distal gut content | None |
| Experiment | genomics | None |
| Index PCR cycles | 12 | None |
| Lab Process ID | LPS00839 | None |
| Omics | Metagenomics | None |
| Organism | Salmon | None |
| Pool | S-MG-P1-502 | None |
| Project | HoloFood | None |
| Raw seq. name | S-MG-P1-502/V300074200_L01_502 | None |
| Sample code | SA01.19C1a | None |
| Sequencing company | BGI | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | Tiger | None |
| Treatment concentration | 0.0% | % |
| Treatment description | Fermented algae meal (added in in oil coating) | None |
| Marker | Measurement | Units |
|---|---|---|
| Environment | Tanks (flow-through) | None |
| Trial code | SA | None |
| Trial description | Trial A: Seaweed-dose response | None |
| Trial end | 2019-08-13 | None |
| Trial start | 2019-06-11 | None |
Sample SAMEA9068671 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 9,373,761,918bp sequenced by 65,249,238 reads. View sample SAMEA9068671 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA9068671 | SA01.19C1a |
| Reads (Run) | ERR5988682 | webin-reads-SA01_19C1a_hostG |
| Reads (Experiment) | ERX5629445 | DNBSEQ-G400 sequencing: Raw reads: SA01_19C1a_hostG |
| Project/Study | PRJEB45274 | HoloFood Salmon Host Genome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA9068671
