HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA8141883: SB11.20C1a

Sample data for SAMEA8141883, a HoloFood metatranscriptomic salmon sample


Sample details
Animal
Salmon SAMEA112948981
Sample type
Metagenomic / metatranscriptomic data icon metatranscriptomic
API endpoint
/api/samples/SAMEA8141883 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA8141883, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA8141883 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:21:33Z None
INSDC last update 2023-03-22T12:21:33Z None
INSDC status public None
SRA accession ERS5828696 None
Submitter Id SB11_20C1a_metaT None
adapters AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT None
collection date 2019-10-14 None
description Salmon meta transcriptomic data from Distal gut content; animal SB11.20 from tank SB11 with treatment Mars None
geographic location (country and/or sea) Norway None
geographic location (latitude) 66.08 DD
geographic location (longitude) 12.588 DD
geographic location (region and locality) Dønna; Nordland county None
host body site Distal gut content None
host common name Atlantic salmon None
host diet Sanford Blue Mussel Meal None
host diet treatment Mars: SB Control None
host diet treatment concentration 0 % mass
host disease status Wounded:- None
host gutted mass 453.2 g
host length 35.2 cm
host scientific name Salmo salar None
host storage container LetSea Tank: Mars None
host storage container pH 7.05 None
host storage container temperature 12.76 °C
host subject id SB11.20 None
host taxid 8030 None
host total mass 512.2 g
library name Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit None
library selection rRNA depletion + strand specific library None
nucleic acid extraction D-rex protocol None
organism fish gut metagenome None
project HoloFood None
project name HoloFood Salmon - MetaTranscriptomics None
reference host genome for decontamination GCA_000000000.0 None
sample storage buffer Shield None
sample storage container 2ml E-matrix None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name fish gut metagenome None
sequencing method Illumina NovaSeq 6000 None
title SB11.20C1a None
trial timepoint 60 day

Sample metadata

Marker Measurement Units
Body site distal gut content None
Experiment metatranscriptomics None
Index PCR cycles 12 None
Lab Process ID LPS00639 None
Omics Metagenomics None
Organism Salmon None
Pool S-MG-P30-518 None
Project HoloFood None
Raw seq. name S-MG-P30-518/V300074385_L02_518 None
Sample code SB11.20C1a None
Sequencing company BGI None

Treatment metadata

Marker Measurement Units
Treatment code Mars None
Treatment concentration 0.0% %
Treatment description Sanford Blue Mussel Meal None

Trial metadata

Marker Measurement Units
Environment Tanks (flow-through) None
Trial code SB None
Trial description Trial B: Blue mussel-dose response None
Trial end 2019-11-22 None
Trial start 2019-08-14 None
Metagenomics

Sample SAMEA8141883 may have been analysed by MGnify. Lookup sample on MGnify

Analyses

Empty set icon

Could not connect to MGnify right now. Please try later.

Analysis accession Run/assembly accession MGnify pipeline version Experiment type Detail
Empty set icon

No analyses found in MGnify

Nucleotide sequencing data

Sample SAMEA8141883 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 934,618,279bp sequenced by 6,270,418 reads. View sample SAMEA8141883 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA8141883 SB11.20C1a
Reads (Run) ERR5377520 webin-reads-SB11_20C1a_metaT
Reads (Experiment) ERX5162511 Illumina NovaSeq 6000 sequencing: Raw reads: SB11_20C1a_metaT
Project/Study PRJEB43098 HoloFood Salmon Trial A+B Gut Metatranscriptome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA8141883