HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA8141858: SB10.20C1a

Sample data for SAMEA8141858, a HoloFood metatranscriptomic salmon sample


Sample details
Animal
Salmon SAMEA112949424
Sample type
Metagenomic / metatranscriptomic data icon metatranscriptomic
API endpoint
/api/samples/SAMEA8141858 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA8141858, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA8141858 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:21:33Z None
INSDC last update 2023-03-22T12:21:33Z None
INSDC status public None
SRA accession ERS5828671 None
Submitter Id SB10_20C1a_metaT None
adapters AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT None
collection date 2019-10-14 None
description Salmon meta transcriptomic data from Distal gut content; animal SB10.20 from tank SB10 with treatment Neptune None
geographic location (country and/or sea) Norway None
geographic location (latitude) 66.08 DD
geographic location (longitude) 12.588 DD
geographic location (region and locality) Dønna; Nordland county None
host body site Distal gut content None
host common name Atlantic salmon None
host diet Sanford Blue Mussel Meal None
host diet treatment Neptune: SB 13.1% blue mussel meal None
host diet treatment concentration 13.1 % mass
host disease status Wounded:- None
host gutted mass 403.4 g
host length 33.9 cm
host scientific name Salmo salar None
host storage container LetSea Tank: Neptune None
host storage container pH 7.05 None
host storage container temperature 12.76 °C
host subject id SB10.20 None
host taxid 8030 None
host total mass 464.8 g
library name Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit None
library selection rRNA depletion + strand specific library None
nucleic acid extraction D-rex protocol None
organism fish gut metagenome None
project HoloFood None
project name HoloFood Salmon - MetaTranscriptomics None
reference host genome for decontamination GCA_000000000.0 None
sample storage buffer Shield None
sample storage container 2ml E-matrix None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name fish gut metagenome None
sequencing method Illumina NovaSeq 6000 None
title SB10.20C1a None
trial timepoint 60 day

Sample metadata

Marker Measurement Units
Body site distal gut content None
Experiment metatranscriptomics None
Index PCR cycles 11 None
Lab Process ID LPS00695 None
Omics Metagenomics None
Organism Salmon None
Pool S-MG-P23-502 None
Project HoloFood None
Raw seq. name S-MG-P23-502/V300074309_L03_502 None
Sample code SB10.20C1a None
Sequencing company BGI None

Treatment metadata

Marker Measurement Units
Treatment code Neptune None
Treatment concentration 13.1% %
Treatment description Sanford Blue Mussel Meal None

Trial metadata

Marker Measurement Units
Environment Tanks (flow-through) None
Trial code SB None
Trial description Trial B: Blue mussel-dose response None
Trial end 2019-11-22 None
Trial start 2019-08-14 None
Metagenomics

Sample SAMEA8141858 may have been analysed by MGnify. Lookup sample on MGnify

Analyses

Empty set icon

Could not connect to MGnify right now. Please try later.

Analysis accession Run/assembly accession MGnify pipeline version Experiment type Detail
Empty set icon

No analyses found in MGnify

Nucleotide sequencing data

Sample SAMEA8141858 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 762,122,802bp sequenced by 5,106,354 reads. View sample SAMEA8141858 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA8141858 SB10.20C1a
Reads (Run) ERR5377497 webin-reads-SB10_20C1a_metaT
Reads (Experiment) ERX5162488 Illumina NovaSeq 6000 sequencing: Raw reads: SB10_20C1a_metaT
Project/Study PRJEB43098 HoloFood Salmon Trial A+B Gut Metatranscriptome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA8141858