No analyses found in MGnify
HoloFood Data Portal
Access samples and data collected and generated by the HoloFood project.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA8141588, a HoloFood metatranscriptomic salmon sample
Metadata for sample SAMEA8141588, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-03-22 | None |
| ENA-LAST-UPDATE | 2023-03-22 | None |
| External Id | SAMEA8141588 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-03-22T12:21:32Z | None |
| INSDC last update | 2023-03-22T12:21:32Z | None |
| INSDC status | public | None |
| SRA accession | ERS5828402 | None |
| Submitter Id | SA03_01C1a_metaT | None |
| adapters | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | None |
| collection date | 2019-06-11 | None |
| description | Salmon meta transcriptomic data from Distal gut content; animal SA03.01 from tank SA03 with treatment Lion | None |
| geographic location (country and/or sea) | Norway | None |
| geographic location (latitude) | 66.08 | DD |
| geographic location (longitude) | 12.588 | DD |
| geographic location (region and locality) | Dønna; Nordland county | None |
| host body site | Distal gut content | None |
| host common name | Atlantic salmon | None |
| host diet | Fermented algae meal (added in in oil coating) | None |
| host diet treatment | Lion: SA 1.0% seaweed | None |
| host diet treatment concentration | 0 | % mass |
| host disease status | Wounded:- | None |
| host gutted mass | 246.4 | g |
| host length | 28 | cm |
| host scientific name | Salmo salar | None |
| host storage container | LetSea Tank: Lion | None |
| host storage container pH | 7.05 | None |
| host storage container temperature | 12.76 | °C |
| host subject id | SA03.01 | None |
| host taxid | 8030 | None |
| host total mass | 276.8 | g |
| library name | Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit | None |
| library selection | rRNA depletion + strand specific library | None |
| nucleic acid extraction | D-rex protocol | None |
| organism | fish gut metagenome | None |
| project | HoloFood | None |
| project name | HoloFood Salmon - MetaTranscriptomics | None |
| reference host genome for decontamination | GCA_000000000.0 | None |
| sample storage buffer | Shield | None |
| sample storage container | 2ml E-matrix | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | fish gut metagenome | None |
| sequencing method | Illumina NovaSeq 6000 | None |
| title | SA03.01C1a | None |
| trial timepoint | 0 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | distal gut content | None |
| Experiment | metatranscriptomics | None |
| Index PCR cycles | 9 | None |
| Lab Process ID | LPS00721 | None |
| Omics | Metagenomics | None |
| Organism | Salmon | None |
| Pool | S-MG-P19-516 | None |
| Project | HoloFood | None |
| Raw seq. name | S-MG-P19-516/V300074285_L03_516 | None |
| Sample code | SA03.01C1a | None |
| Sequencing company | BGI | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | Lion | None |
| Treatment concentration | 1.0% | % |
| Treatment description | Fermented algae meal (added in in oil coating) | None |
| Marker | Measurement | Units |
|---|---|---|
| Environment | Tanks (flow-through) | None |
| Trial code | SA | None |
| Trial description | Trial A: Seaweed-dose response | None |
| Trial end | 2019-08-13 | None |
| Trial start | 2019-06-11 | None |
Sample SAMEA8141588 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
|---|
No analyses found in MGnify
Sample SAMEA8141588 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 726,504,035bp sequenced by 4,866,130 reads. View sample SAMEA8141588 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA8141588 | SA03.01C1a |
| Reads (Run) | ERR5377524 | webin-reads-SA03_01C1a_metaT |
| Reads (Experiment) | ERX5162515 | Illumina NovaSeq 6000 sequencing: Raw reads: SA03_01C1a_metaT |
| Project/Study | PRJEB43098 | HoloFood Salmon Trial A+B Gut Metatranscriptome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA8141588