Could not connect to MGnify right now. Please try later.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA8141569, a HoloFood metatranscriptomic salmon sample
Metadata for sample SAMEA8141569, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-03-22 | None |
| ENA-LAST-UPDATE | 2023-03-22 | None |
| External Id | SAMEA8141569 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-03-22T12:21:33Z | None |
| INSDC last update | 2023-03-22T12:21:33Z | None |
| INSDC status | public | None |
| SRA accession | ERS5828383 | None |
| Submitter Id | SA02_12C1a_metaT | None |
| adapters | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | None |
| collection date | 2019-08-12 | None |
| description | Salmon meta transcriptomic data from Distal gut content; animal SA02.12 from tank SA02 with treatment Jaguar | None |
| geographic location (country and/or sea) | Norway | None |
| geographic location (latitude) | 66.08 | DD |
| geographic location (longitude) | 12.588 | DD |
| geographic location (region and locality) | Dønna; Nordland county | None |
| host body site | Distal gut content | None |
| host common name | Atlantic salmon | None |
| host diet | Fermented algae meal (added in in oil coating) | None |
| host diet treatment | Jaguar: SA 2.0% seaweed | None |
| host diet treatment concentration | 2 | % mass |
| host disease status | Wounded:- | None |
| host gutted mass | 508.6 | g |
| host length | 34 | cm |
| host scientific name | Salmo salar | None |
| host storage container | LetSea Tank: Jaguar | None |
| host storage container pH | 7.05 | None |
| host storage container temperature | 12.76 | °C |
| host subject id | SA02.12 | None |
| host taxid | 8030 | None |
| host total mass | 605.8 | g |
| library name | Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit | None |
| library selection | rRNA depletion + strand specific library | None |
| nucleic acid extraction | D-rex protocol | None |
| organism | fish gut metagenome | None |
| project | HoloFood | None |
| project name | HoloFood Salmon - MetaTranscriptomics | None |
| reference host genome for decontamination | GCA_000000000.0 | None |
| sample storage buffer | Shield | None |
| sample storage container | 2ml E-matrix | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | fish gut metagenome | None |
| sequencing method | Illumina NovaSeq 6000 | None |
| title | SA02.12C1a | None |
| trial timepoint | 60 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | distal gut content | None |
| Experiment | metatranscriptomics | None |
| Index PCR cycles | 9 | None |
| Lab Process ID | LPS00795 | None |
| Omics | Metagenomics | None |
| Organism | Salmon | None |
| Pool | S-MG-P6-514 | None |
| Project | HoloFood | None |
| Raw seq. name | S-MG-P6-514/V300074202_L02_514 | None |
| Sample code | SA02.12C1a | None |
| Sequencing company | BGI | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | Jaguar | None |
| Treatment concentration | 2.0% | % |
| Treatment description | Fermented algae meal (added in in oil coating) | None |
| Marker | Measurement | Units |
|---|---|---|
| Environment | Tanks (flow-through) | None |
| Trial code | SA | None |
| Trial description | Trial A: Seaweed-dose response | None |
| Trial end | 2019-08-13 | None |
| Trial start | 2019-06-11 | None |
Sample SAMEA8141569 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
|---|
No analyses found in MGnify
Sample SAMEA8141569 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 409,624,928bp sequenced by 2,745,692 reads. View sample SAMEA8141569 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA8141569 | SA02.12C1a |
| Reads (Run) | ERR5377209 | webin-reads-SA02_12C1a_metaT |
| Reads (Experiment) | ERX5162200 | Illumina NovaSeq 6000 sequencing: Raw reads: SA02_12C1a_metaT |
| Project/Study | PRJEB43098 | HoloFood Salmon Trial A+B Gut Metatranscriptome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA8141569