HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA8141563: SA02.01C1a

Sample data for SAMEA8141563, a HoloFood metatranscriptomic salmon sample


Sample details
Animal
Salmon SAMEA112949095
Sample type
Metagenomic / metatranscriptomic data icon metatranscriptomic
API endpoint
/api/samples/SAMEA8141563 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA8141563, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA8141563 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:21:32Z None
INSDC last update 2023-03-22T12:21:32Z None
INSDC status public None
SRA accession ERS5828377 None
Submitter Id SA02_01C1a_metaT None
adapters AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT None
collection date 2019-06-11 None
description Salmon meta transcriptomic data from Distal gut content; animal SA02.01 from tank SA02 with treatment Jaguar None
geographic location (country and/or sea) Norway None
geographic location (latitude) 66.08 DD
geographic location (longitude) 12.588 DD
geographic location (region and locality) Dønna; Nordland county None
host body site Distal gut content None
host common name Atlantic salmon None
host diet Fermented algae meal (added in in oil coating) None
host diet treatment Jaguar: SA 2.0% seaweed None
host diet treatment concentration 0 % mass
host disease status Wounded:- None
host gutted mass 247.4 g
host length 27.5 cm
host scientific name Salmo salar None
host storage container LetSea Tank: Jaguar None
host storage container pH 7.05 None
host storage container temperature 12.76 °C
host subject id SA02.01 None
host taxid 8030 None
host total mass 295.6 g
library name Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit None
library selection rRNA depletion + strand specific library None
nucleic acid extraction D-rex protocol None
organism fish gut metagenome None
project HoloFood None
project name HoloFood Salmon - MetaTranscriptomics None
reference host genome for decontamination GCA_000000000.0 None
sample storage buffer Shield None
sample storage container 2ml E-matrix None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name fish gut metagenome None
sequencing method Illumina NovaSeq 6000 None
title SA02.01C1a None
trial timepoint 0 day

Sample metadata

Marker Measurement Units
Body site distal gut content None
Experiment metatranscriptomics None
Index PCR cycles 7 None
Lab Process ID LPS00577 None
Omics Metagenomics None
Organism Salmon None
Pool S-MG-P37-508 None
Project HoloFood None
Raw seq. name S-MG-P37-508/V300074241_L01_508 None
Sample code SA02.01C1a None
Sequencing company BGI None

Treatment metadata

Marker Measurement Units
Treatment code Jaguar None
Treatment concentration 2.0% %
Treatment description Fermented algae meal (added in in oil coating) None

Trial metadata

Marker Measurement Units
Environment Tanks (flow-through) None
Trial code SA None
Trial description Trial A: Seaweed-dose response None
Trial end 2019-08-13 None
Trial start 2019-06-11 None
Metagenomics

Sample SAMEA8141563 may have been analysed by MGnify. Lookup sample on MGnify

Analyses

Empty set icon

Could not connect to MGnify right now. Please try later.

Analysis accession Run/assembly accession MGnify pipeline version Experiment type Detail
Empty set icon

No analyses found in MGnify

Nucleotide sequencing data

Sample SAMEA8141563 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 201,199,509bp sequenced by 1,350,078 reads. View sample SAMEA8141563 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA8141563 SA02.01C1a
Reads (Run) ERR5376989 webin-reads-SA02_01C1a_metaT
Reads (Experiment) ERX5162075 Illumina NovaSeq 6000 sequencing: Raw reads: SA02_01C1a_metaT
Project/Study PRJEB43098 HoloFood Salmon Trial A+B Gut Metatranscriptome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA8141563