Could not connect to MGnify right now. Please try later.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA8141554, a HoloFood metatranscriptomic salmon sample
Metadata for sample SAMEA8141554, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-03-22 | None |
| ENA-LAST-UPDATE | 2023-03-22 | None |
| External Id | SAMEA8141554 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-03-22T12:21:32Z | None |
| INSDC last update | 2023-03-22T12:21:32Z | None |
| INSDC status | public | None |
| SRA accession | ERS5828368 | None |
| Submitter Id | SA01_22C1a_metaT | None |
| adapters | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | None |
| collection date | 2019-08-12 | None |
| description | Salmon meta transcriptomic data from Distal gut content; animal SA01.22 from tank SA01 with treatment Tiger | None |
| geographic location (country and/or sea) | Norway | None |
| geographic location (latitude) | 66.08 | DD |
| geographic location (longitude) | 12.588 | DD |
| geographic location (region and locality) | Dønna; Nordland county | None |
| host body site | Distal gut content | None |
| host common name | Atlantic salmon | None |
| host diet | Fermented algae meal (added in in oil coating) | None |
| host diet treatment | Tiger: SA Control | None |
| host diet treatment concentration | 0 | % mass |
| host disease status | Wounded:- | None |
| host gutted mass | 437 | g |
| host length | 32.5 | cm |
| host scientific name | Salmo salar | None |
| host storage container | LetSea Tank: Tiger | None |
| host storage container pH | 7.05 | None |
| host storage container temperature | 12.76 | °C |
| host subject id | SA01.22 | None |
| host taxid | 8030 | None |
| host total mass | 533.8 | g |
| library name | Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit | None |
| library selection | rRNA depletion + strand specific library | None |
| nucleic acid extraction | D-rex protocol | None |
| organism | fish gut metagenome | None |
| project | HoloFood | None |
| project name | HoloFood Salmon - MetaTranscriptomics | None |
| reference host genome for decontamination | GCA_000000000.0 | None |
| sample storage buffer | Shield | None |
| sample storage container | 2ml E-matrix | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | fish gut metagenome | None |
| sequencing method | Illumina NovaSeq 6000 | None |
| title | SA01.22C1a | None |
| trial timepoint | 60 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | distal gut content | None |
| Experiment | metatranscriptomics | None |
| Index PCR cycles | 12 | None |
| Lab Process ID | LPS00787 | None |
| Omics | Metagenomics | None |
| Organism | Salmon | None |
| Pool | S-MG-P7-522 | None |
| Project | HoloFood | None |
| Raw seq. name | S-MG-P7-522/V300074202_L03_522 | None |
| Sample code | SA01.22C1a | None |
| Sequencing company | BGI | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | Tiger | None |
| Treatment concentration | 0.0% | % |
| Treatment description | Fermented algae meal (added in in oil coating) | None |
| Marker | Measurement | Units |
|---|---|---|
| Environment | Tanks (flow-through) | None |
| Trial code | SA | None |
| Trial description | Trial A: Seaweed-dose response | None |
| Trial end | 2019-08-13 | None |
| Trial start | 2019-06-11 | None |
Sample SAMEA8141554 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
|---|
No analyses found in MGnify
Sample SAMEA8141554 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 756,421,056bp sequenced by 5,088,004 reads. View sample SAMEA8141554 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA8141554 | SA01.22C1a |
| Reads (Run) | ERR5377505 | webin-reads-SA01_22C1a_metaT |
| Reads (Experiment) | ERX5162496 | Illumina NovaSeq 6000 sequencing: Raw reads: SA01_22C1a_metaT |
| Project/Study | PRJEB43098 | HoloFood Salmon Trial A+B Gut Metatranscriptome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA8141554