HoloFood Data Portal
Access samples and data collected and generated by the HoloFood project.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA7697605, a HoloFood metagenomic-assembly chicken sample
Metadata for sample SAMEA7697605, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-03-22 | None |
| ENA-LAST-UPDATE | 2023-03-22 | None |
| External Id | SAMEA7697605 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-03-22T12:21:28Z | None |
| INSDC last update | 2023-03-22T12:21:28Z | None |
| INSDC status | public | None |
| SRA accession | ERS5454122 | None |
| Submitter Id | CC02_16F1a_metaG | None |
| adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT | None |
| collection date | 2019-10-15 | None |
| description | Prior chicken data from Caecum content; animal CC02.16 from cage CC02 with treatment CO | None |
| geographic location (country and/or sea) | Spain | None |
| geographic location (latitude) | 41.17 | DD |
| geographic location (longitude) | 1.1685 | DD |
| geographic location (region and locality) | El Morell; Tarragona | None |
| host body site | Caecum content | None |
| host breed | Cobb | None |
| host common name | Chicken | None |
| host diet treatment | Probiotic | None |
| host disease status | Campylobacter:NS;Salmonella:NS;Clostridium:NS | None |
| host scientific name | Gallus gallus | None |
| host sex | female | None |
| host storage container temperature | 21 | °C |
| host subject id | CC02.16 | None |
| host taxid | 9031 | None |
| host total mass | 2060 | g |
| nucleic acid extraction | D-rex protocol | None |
| organism | chicken gut metagenome | None |
| project | HoloFood | None |
| project name | HoloFood Chicken - Prior Chicken | None |
| reference host genome for decontamination | GCF_000002315.6 | None |
| sample storage buffer | Shield | None |
| sample storage container | E-matrix 2ml | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | chicken gut metagenome | None |
| sequencing method | MGISEQ-2000 | None |
| title | CC02.16F1a | None |
| trial length | 35 | day |
| trial timepoint | 35 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | caecum content | None |
| Experiment | metagenomics | None |
| Index PCR cycles | 6 | None |
| Lab Process ID | LPC00127 | None |
| Organism | Chicken | None |
| Pool | PRICH-21BM-510 | None |
| Project | HoloFood | None |
| Raw sequence name | F20FTSEUHT1189_GALkbvR/PRICH-21BM/PRICH-21BM-510 | None |
| Sample code | CC02.16F1a | None |
| Sequencing company | BGI | None |
| ng used for library build | 392.4 | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | CO | None |
| Treatment name | Probiotic | None |
| Marker | Measurement | Units |
|---|---|---|
| Trial code | CC | None |
| Trial description | Trial 3 | None |
| Trial end | 2019-07-14 | None |
| Trial start | 2019-06-09 | None |
Sample SAMEA7697605 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
|---|---|---|---|---|
| MGYA00615972 | ERZ2916547 | 5.0 | assembly | View on MGnify |
Sample SAMEA7697605 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 3,254,746,056bp sequenced by 22,275,522 reads. View sample SAMEA7697605 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA7697605 | CC02.16F1a |
| Reads (Run) | ERR4968564 | webin-reads-CC02_16F1a_metaG |
| Reads (Experiment) | ERX4787761 | DNBSEQ-G400 paired end sequencing: Raw reads: CC02_16F1a_metaG |
| Project/Study | PRJEB41323 | HoloFood Chicken Caecum Metagenome – deeply sequenced batch |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA7697605
