Could not connect to MGnify right now. Please try later.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA7697585, a HoloFood metagenomic-assembly chicken sample
Metadata for sample SAMEA7697585, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-03-22 | None |
| ENA-LAST-UPDATE | 2023-03-22 | None |
| External Id | SAMEA7697585 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-03-22T12:21:28Z | None |
| INSDC last update | 2023-03-22T12:21:28Z | None |
| INSDC status | public | None |
| SRA accession | ERS5454102 | None |
| Submitter Id | CB01_09F1a_metaG | None |
| adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT | None |
| collection date | 2019-05-20 | None |
| description | Prior chicken data from Caecum content; animal CB01.09 from cage CB01 with treatment CE | None |
| geographic location (country and/or sea) | Spain | None |
| geographic location (latitude) | 41.17 | DD |
| geographic location (longitude) | 1.1685 | DD |
| geographic location (region and locality) | El Morell; Tarragona | None |
| host body site | Caecum content | None |
| host breed | Cobb | None |
| host common name | Chicken | None |
| host diet treatment | Prebiotic | None |
| host disease status | Campylobacter:-;Salmonella:-;Clostridium:- | None |
| host scientific name | Gallus gallus | None |
| host sex | female | None |
| host storage container temperature | 21 | °C |
| host subject id | CB01.09 | None |
| host taxid | 9031 | None |
| host total mass | 950 | g |
| nucleic acid extraction | D-rex protocol | None |
| organism | chicken gut metagenome | None |
| project | HoloFood | None |
| project name | HoloFood Chicken - Prior Chicken | None |
| reference host genome for decontamination | GCF_000002315.6 | None |
| sample storage buffer | Shield | None |
| sample storage container | E-matrix 2ml | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | chicken gut metagenome | None |
| sequencing method | MGISEQ-2000 | None |
| title | CB01.09F1a | None |
| trial length | 35 | day |
| trial timepoint | 21 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | caecum content | None |
| Experiment | metagenomics | None |
| Index PCR cycles | 10 | None |
| Lab Process ID | LPC00129 | None |
| Organism | Chicken | None |
| Pool | PRICH-20BM-514 | None |
| Project | HoloFood | None |
| Raw sequence name | F20FTSEUHT1189_GALkbvR/PRICH-20BM/PRICH-20BM-514 | None |
| Sample code | CB01.09F1a | None |
| Sequencing company | BGI | None |
| ng used for library build | 94.4 | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | CE | None |
| Treatment name | Prebiotic | None |
| Marker | Measurement | Units |
|---|---|---|
| Trial code | CB | None |
| Trial description | Trial 2 | None |
| Trial end | 2019-05-19 | None |
| Trial start | 2019-04-21 | None |
Sample SAMEA7697585 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
|---|
No analyses found in MGnify
Sample SAMEA7697585 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 13,452,468,837bp sequenced by 91,628,004 reads. View sample SAMEA7697585 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA7697585 | CB01.09F1a |
| Reads (Run) | ERR4968600 | webin-reads-CB01_09F1a_metaG |
| Reads (Experiment) | ERX4787797 | DNBSEQ-G400 paired end sequencing: Raw reads: CB01_09F1a_metaG |
| Project/Study | PRJEB41323 | HoloFood Chicken Caecum Metagenome – deeply sequenced batch |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA7697585