Could not connect to MGnify right now. Please try later.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA7688228, a HoloFood metagenomic-assembly salmon sample
Metadata for sample SAMEA7688228, stored in BioSamples and ENA.
Download all as TSVMarker | Measurement | Units |
---|---|---|
ENA-CHECKLIST | ERC000052 | None |
ENA-FIRST-PUBLIC | 2022-08-02 | None |
ENA-LAST-UPDATE | 2022-08-02 | None |
External Id | SAMEA7688228 | None |
INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
INSDC center name | UNIVERSITY OF COPENHAGEN | None |
INSDC first public | 2022-08-02T16:46:24Z | None |
INSDC last update | 2022-08-02T16:46:24Z | None |
INSDC status | public | None |
Organism | Salmo salar | None |
SRA accession | ERS5444757 | None |
Submitter Id | SB11_26C1a_metaG | None |
adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT | None |
collection date | 2019-10-14 | None |
description | Salmon metagenomic DNA data from Distal gut content; animal SB11.26 from tank SB11 with treatment Mars | None |
geographic location (country and/or sea) | Norway | None |
geographic location (latitude) | 66.08 | DD |
geographic location (longitude) | 12.588 | DD |
geographic location (region and locality) | Dønna; Nordland county | None |
host body site | Distal gut content | None |
host common name | Atlantic salmon | None |
host diet | Sanford Blue Mussel Meal | None |
host diet treatment | Mars: SB Control | None |
host diet treatment concentration | 0 | % mass |
host disease status | Wounded:- | None |
host gutted mass | 357.2 | g |
host length | 32.4 | cm |
host scientific name | Salmo salar | None |
host storage container | LetSea Tank: Mars | None |
host storage container pH | 7.05 | None |
host storage container temperature | 12.76 | °C |
host subject id | SB11.26 | None |
host taxid | 8030 | None |
host total mass | 412.8 | g |
nucleic acid extraction | D-rex protocol | None |
organism | fish gut metagenome | None |
project | HoloFood | None |
project name | HoloFood Salmon - Metagenomic DNA | None |
reference host genome for decontamination | GCA_000000000.0 | None |
sample storage buffer | Shield | None |
sample storage container | 2ml E-matrix | None |
sample storage location | UCPH | None |
sample storage temperature | -20 | °C |
sample volume or weight for DNA extraction | 0.2 | mL |
sequencing method | MGISEQ-2000 | None |
title | SB11.26C1a | None |
trial timepoint | 60 | day |
Marker | Measurement | Units |
---|---|---|
Body site | distal gut content | None |
Experiment | metagenomics | None |
Index PCR cycles | 12 | None |
Lab Process ID | LPS00607 | None |
Omics | Metagenomics | None |
Organism | Salmon | None |
Pool | S-MG-P34-526 | None |
Project | HoloFood | None |
Raw seq. name | S-MG-P34-526/V300074173_L02_526 | None |
Sample code | SB11.26C1a | None |
Sequencing company | BGI | None |
Marker | Measurement | Units |
---|---|---|
Treatment code | Mars | None |
Treatment concentration | 0.0% | % |
Treatment description | Sanford Blue Mussel Meal | None |
Marker | Measurement | Units |
---|---|---|
Environment | Tanks (flow-through) | None |
Trial code | SB | None |
Trial description | Trial B: Blue mussel-dose response | None |
Trial end | 2019-11-22 | None |
Trial start | 2019-08-14 | None |
Sample SAMEA7688228 may have been analysed by MGnify. Lookup sample on MGnify
Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
---|
No analyses found in MGnify
Sample SAMEA7688228 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 167,408,386bp sequenced by 1,136,012 reads. View sample SAMEA7688228 in ENA
Data domain | Accession | Title/alias |
---|---|---|
Sample | SAMEA7688228 | SB11.26C1a |
Reads (Run) | ERR4918719 | webin-reads-SB11_26C1a_metaG |
Reads (Experiment) | ERX4783628 | DNBSEQ-G400 paired end sequencing: Raw reads: SB11_26C1a_metaG |
Project/Study | PRJEB41657 | HoloFood Salmon Trial A+B Gut Metagenome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA7688228