Could not connect to MGnify right now. Please try later.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA7688182, a HoloFood metagenomic-assembly salmon sample
Metadata for sample SAMEA7688182, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2022-08-02 | None |
| ENA-LAST-UPDATE | 2022-08-02 | None |
| External Id | SAMEA7688182 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2022-08-02T16:46:25Z | None |
| INSDC last update | 2022-08-02T16:46:25Z | None |
| INSDC status | public | None |
| Organism | Salmo salar | None |
| SRA accession | ERS5444711 | None |
| Submitter Id | SB09_04C1a_metaG | None |
| adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT | None |
| collection date | 2019-08-14 | None |
| description | Salmon metagenomic DNA data from Distal gut content; animal SB09.04 from tank SB09 with treatment Saturn | None |
| geographic location (country and/or sea) | Norway | None |
| geographic location (latitude) | 66.08 | DD |
| geographic location (longitude) | 12.588 | DD |
| geographic location (region and locality) | Dønna; Nordland county | None |
| host body site | Distal gut content | None |
| host common name | Atlantic salmon | None |
| host diet | Sanford Blue Mussel Meal | None |
| host diet treatment | Saturn: SB 4.4% blue mussel meal | None |
| host diet treatment concentration | 0 | % mass |
| host disease status | Wounded:- | None |
| host gutted mass | 177.6 | g |
| host length | 26.5 | cm |
| host scientific name | Salmo salar | None |
| host storage container | LetSea Tank: Saturn | None |
| host storage container pH | 7.05 | None |
| host storage container temperature | 12.76 | °C |
| host subject id | SB09.04 | None |
| host taxid | 8030 | None |
| host total mass | 209.8 | g |
| nucleic acid extraction | D-rex protocol | None |
| organism | fish gut metagenome | None |
| project | HoloFood | None |
| project name | HoloFood Salmon - Metagenomic DNA | None |
| reference host genome for decontamination | GCA_000000000.0 | None |
| sample storage buffer | Shield | None |
| sample storage container | 2ml E-matrix | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| sequencing method | MGISEQ-2000 | None |
| title | SB09.04C1a | None |
| trial timepoint | 0 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | distal gut content | None |
| Experiment | metagenomics | None |
| Index PCR cycles | 12 | None |
| Lab Process ID | LPS00618 | None |
| Omics | Metagenomics | None |
| Organism | Salmon | None |
| Pool | S-MG-P32-531 | None |
| Project | HoloFood | None |
| Raw seq. name | S-MG-P32-531/V300074385_L04_531 | None |
| Sample code | SB09.04C1a | None |
| Sequencing company | BGI | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | Saturn | None |
| Treatment concentration | 4.4% | % |
| Treatment description | Sanford Blue Mussel Meal | None |
| Marker | Measurement | Units |
|---|---|---|
| Environment | Tanks (flow-through) | None |
| Trial code | SB | None |
| Trial description | Trial B: Blue mussel-dose response | None |
| Trial end | 2019-11-22 | None |
| Trial start | 2019-08-14 | None |
Sample SAMEA7688182 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
|---|
No analyses found in MGnify
Sample SAMEA7688182 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 47,591,458bp sequenced by 339,588 reads. View sample SAMEA7688182 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA7688182 | SB09.04C1a |
| Reads (Run) | ERR4918668 | webin-reads-SB09_04C1a_metaG |
| Reads (Experiment) | ERX4783577 | DNBSEQ-G400 paired end sequencing: Raw reads: SB09_04C1a_metaG |
| Project/Study | PRJEB41657 | HoloFood Salmon Trial A+B Gut Metagenome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA7688182