HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA7688141: SB06.23C1a

Sample data for SAMEA7688141, a HoloFood metagenomic-assembly salmon sample


Sample details
Animal
Salmon SAMEA112949202
Sample type
Metagenomic / metatranscriptomic data icon metagenomic-assembly
API endpoint
/api/samples/SAMEA7688141 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA7688141, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2022-08-02 None
ENA-LAST-UPDATE 2022-08-02 None
External Id SAMEA7688141 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2022-08-02T16:46:24Z None
INSDC last update 2022-08-02T16:46:24Z None
INSDC status public None
Organism Salmo salar None
SRA accession ERS5444670 None
Submitter Id SB06_23C1a_metaG None
adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT None
collection date 2019-10-14 None
description Salmon metagenomic DNA data from Distal gut content; animal SB06.23 from tank SB06 with treatment Mars None
geographic location (country and/or sea) Norway None
geographic location (latitude) 66.08 DD
geographic location (longitude) 12.588 DD
geographic location (region and locality) Dønna; Nordland county None
host body site Distal gut content None
host common name Atlantic salmon None
host diet Sanford Blue Mussel Meal None
host diet treatment Mars: SB Control None
host diet treatment concentration 0 % mass
host disease status Wounded:- None
host gutted mass 431 g
host length 34 cm
host scientific name Salmo salar None
host storage container LetSea Tank: Mars None
host storage container pH 7.05 None
host storage container temperature 12.76 °C
host subject id SB06.23 None
host taxid 8030 None
host total mass 495.6 g
nucleic acid extraction D-rex protocol None
organism fish gut metagenome None
project HoloFood None
project name HoloFood Salmon - Metagenomic DNA None
reference host genome for decontamination GCA_000000000.0 None
sample storage buffer Shield None
sample storage container 2ml E-matrix None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
sequencing method MGISEQ-2000 None
title SB06.23C1a None
trial timepoint 60 day

Sample metadata

Marker Measurement Units
Body site distal gut content None
Experiment metagenomics None
Index PCR cycles 12 None
Lab Process ID LPS00526 None
Omics Metagenomics None
Organism Salmon None
Pool S-MG-P44-519 None
Project HoloFood None
Raw seq. name S-MG-P44-519/V300074262_L04_519 None
Sample code SB06.23C1a None
Sequencing company BGI None

Treatment metadata

Marker Measurement Units
Treatment code Mars None
Treatment concentration 0.0% %
Treatment description Sanford Blue Mussel Meal None

Trial metadata

Marker Measurement Units
Environment Tanks (flow-through) None
Trial code SB None
Trial description Trial B: Blue mussel-dose response None
Trial end 2019-11-22 None
Trial start 2019-08-14 None
Metagenomics

Sample SAMEA7688141 may have been analysed by MGnify. Lookup sample on MGnify

Analyses

Analysis accession Run/assembly accession MGnify pipeline version Experiment type Detail
MGYA00606201 ERR4918627 5.0 metagenomic View on MGnify
MGYA00607962 ERZ2627197 5.0 assembly View on MGnify
Nucleotide sequencing data

Sample SAMEA7688141 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 112,435,205bp sequenced by 769,850 reads. View sample SAMEA7688141 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA7688141 SB06.23C1a
Reads (Run) ERR4918627 webin-reads-SB06_23C1a_metaG
Reads (Experiment) ERX4783536 DNBSEQ-G400 paired end sequencing: Raw reads: SB06_23C1a_metaG
Project/Study PRJEB41657 HoloFood Salmon Trial A+B Gut Metagenome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA7688141