Could not connect to MGnify right now. Please try later.
HoloFood Data Portal
Access samples and data collected and generated by the HoloFood project.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA7688028, a HoloFood metagenomic-assembly salmon sample
Metadata for sample SAMEA7688028, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2022-08-02 | None |
| ENA-LAST-UPDATE | 2022-08-02 | None |
| External Id | SAMEA7688028 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2022-08-02T16:46:26Z | None |
| INSDC last update | 2022-08-02T16:46:26Z | None |
| INSDC status | public | None |
| Organism | Salmo salar | None |
| SRA accession | ERS5444557 | None |
| Submitter Id | SA10_30C1a_metaG | None |
| adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT | None |
| collection date | 2019-08-12 | None |
| description | Salmon metagenomic DNA data from Distal gut content; animal SA10.30 from tank SA10 with treatment Jaguar | None |
| geographic location (country and/or sea) | Norway | None |
| geographic location (latitude) | 66.08 | DD |
| geographic location (longitude) | 12.588 | DD |
| geographic location (region and locality) | Dønna; Nordland county | None |
| host body site | Distal gut content | None |
| host common name | Atlantic salmon | None |
| host diet | Fermented algae meal (added in in oil coating) | None |
| host diet treatment | Jaguar: SA 2.0% seaweed | None |
| host diet treatment concentration | 2 | % mass |
| host disease status | Wounded:- | None |
| host gutted mass | 530.2 | g |
| host length | 35 | cm |
| host scientific name | Salmo salar | None |
| host storage container | LetSea Tank: Jaguar | None |
| host storage container pH | 7.05 | None |
| host storage container temperature | 12.76 | °C |
| host subject id | SA10.30 | None |
| host taxid | 8030 | None |
| host total mass | 622.2 | g |
| nucleic acid extraction | D-rex protocol | None |
| organism | fish gut metagenome | None |
| project | HoloFood | None |
| project name | HoloFood Salmon - Metagenomic DNA | None |
| reference host genome for decontamination | GCA_000000000.0 | None |
| sample storage buffer | Shield | None |
| sample storage container | 2ml E-matrix | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| sequencing method | MGISEQ-2000 | None |
| title | SA10.30C1a | None |
| trial timepoint | 60 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | distal gut content | None |
| Experiment | metagenomics | None |
| Index PCR cycles | 10 | None |
| Lab Process ID | LPS00783 | None |
| Omics | Metagenomics | None |
| Organism | Salmon | None |
| Pool | S-MG-P8-526 | None |
| Project | HoloFood | None |
| Raw seq. name | S-MG-P8-526/V300074202_L04_526 | None |
| Sample code | SA10.30C1a | None |
| Sequencing company | BGI | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | Jaguar | None |
| Treatment concentration | 2.0% | % |
| Treatment description | Fermented algae meal (added in in oil coating) | None |
| Marker | Measurement | Units |
|---|---|---|
| Environment | Tanks (flow-through) | None |
| Trial code | SA | None |
| Trial description | Trial A: Seaweed-dose response | None |
| Trial end | 2019-08-13 | None |
| Trial start | 2019-06-11 | None |
Sample SAMEA7688028 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
|---|
No analyses found in MGnify
Sample SAMEA7688028 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 55,443,615bp sequenced by 378,796 reads. View sample SAMEA7688028 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA7688028 | SA10.30C1a |
| Reads (Run) | ERR4918533 | webin-reads-SA10_30C1a_metaG |
| Reads (Experiment) | ERX4783442 | DNBSEQ-G400 paired end sequencing: Raw reads: SA10_30C1a_metaG |
| Project/Study | PRJEB41657 | HoloFood Salmon Trial A+B Gut Metagenome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA7688028