HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA7688021: SA10.23C1a

Sample data for SAMEA7688021, a HoloFood metagenomic-assembly salmon sample


Sample details
Animal
Salmon SAMEA112948924
Sample type
Metagenomic / metatranscriptomic data icon metagenomic-assembly
API endpoint
/api/samples/SAMEA7688021 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA7688021, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2022-08-02 None
ENA-LAST-UPDATE 2022-08-02 None
External Id SAMEA7688021 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2022-08-02T16:46:26Z None
INSDC last update 2022-08-02T16:46:26Z None
INSDC status public None
Organism Salmo salar None
SRA accession ERS5444550 None
Submitter Id SA10_23C1a_metaG None
adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT None
collection date 2019-08-12 None
description Salmon metagenomic DNA data from Distal gut content; animal SA10.23 from tank SA10 with treatment Jaguar None
geographic location (country and/or sea) Norway None
geographic location (latitude) 66.08 DD
geographic location (longitude) 12.588 DD
geographic location (region and locality) Dønna; Nordland county None
host body site Distal gut content None
host common name Atlantic salmon None
host diet Fermented algae meal (added in in oil coating) None
host diet treatment Jaguar: SA 2.0% seaweed None
host diet treatment concentration 2 % mass
host disease status Wounded:- None
host gutted mass 408.2 g
host length 34 cm
host scientific name Salmo salar None
host storage container LetSea Tank: Jaguar None
host storage container pH 7.05 None
host storage container temperature 12.76 °C
host subject id SA10.23 None
host taxid 8030 None
host total mass 471 g
nucleic acid extraction D-rex protocol None
organism fish gut metagenome None
project HoloFood None
project name HoloFood Salmon - Metagenomic DNA None
reference host genome for decontamination GCA_000000000.0 None
sample storage buffer Shield None
sample storage container 2ml E-matrix None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
sequencing method MGISEQ-2000 None
title SA10.23C1a None
trial timepoint 60 day

Sample metadata

Marker Measurement Units
Body site distal gut content None
Experiment metagenomics None
Index PCR cycles 12 None
Lab Process ID LPS00559 None
Omics Metagenomics None
Organism Salmon None
Pool S-MG-P40-518 None
Project HoloFood None
Raw seq. name S-MG-P40-518/V300074241_L04_518 None
Sample code SA10.23C1a None
Sequencing company BGI None

Treatment metadata

Marker Measurement Units
Treatment code Jaguar None
Treatment concentration 2.0% %
Treatment description Fermented algae meal (added in in oil coating) None

Trial metadata

Marker Measurement Units
Environment Tanks (flow-through) None
Trial code SA None
Trial description Trial A: Seaweed-dose response None
Trial end 2019-08-13 None
Trial start 2019-06-11 None
Metagenomics

Sample SAMEA7688021 may have been analysed by MGnify. Lookup sample on MGnify

Analyses

Analysis accession Run/assembly accession MGnify pipeline version Experiment type Detail
MGYA00606321 ERR4918524 5.0 metagenomic View on MGnify
MGYA00608055 ERZ2627153 5.0 assembly View on MGnify
Nucleotide sequencing data

Sample SAMEA7688021 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 168,318,088bp sequenced by 1,146,448 reads. View sample SAMEA7688021 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA7688021 SA10.23C1a
Reads (Run) ERR4918524 webin-reads-SA10_23C1a_metaG
Reads (Experiment) ERX4783433 DNBSEQ-G400 paired end sequencing: Raw reads: SA10_23C1a_metaG
Project/Study PRJEB41657 HoloFood Salmon Trial A+B Gut Metagenome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA7688021