HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA7687990: SA07.27C1a

Sample data for SAMEA7687990, a HoloFood metagenomic-assembly salmon sample


Sample details
Animal
Salmon SAMEA112949369
Sample type
Metagenomic / metatranscriptomic data icon metagenomic-assembly
API endpoint
/api/samples/SAMEA7687990 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA7687990, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2022-08-02 None
ENA-LAST-UPDATE 2022-08-02 None
External Id SAMEA7687990 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2022-08-02T16:46:25Z None
INSDC last update 2022-08-02T16:46:25Z None
INSDC status public None
Organism Salmo salar None
SRA accession ERS5444519 None
Submitter Id SA07_27C1a_metaG None
adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT None
collection date 2019-08-12 None
description Salmon metagenomic DNA data from Distal gut content; animal SA07.27 from tank SA07 with treatment Jaguar None
geographic location (country and/or sea) Norway None
geographic location (latitude) 66.08 DD
geographic location (longitude) 12.588 DD
geographic location (region and locality) Dønna; Nordland county None
host body site Distal gut content None
host common name Atlantic salmon None
host diet Fermented algae meal (added in in oil coating) None
host diet treatment Jaguar: SA 2.0% seaweed None
host diet treatment concentration 2 % mass
host disease status Wounded:- None
host gutted mass 570.2 g
host length 36.5 cm
host scientific name Salmo salar None
host storage container LetSea Tank: Jaguar None
host storage container pH 7.05 None
host storage container temperature 12.76 °C
host subject id SA07.27 None
host taxid 8030 None
host total mass 667.6 g
nucleic acid extraction D-rex protocol None
organism fish gut metagenome None
project HoloFood None
project name HoloFood Salmon - Metagenomic DNA None
reference host genome for decontamination GCA_000000000.0 None
sample storage buffer Shield None
sample storage container 2ml E-matrix None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
sequencing method MGISEQ-2000 None
title SA07.27C1a None
trial timepoint 60 day

Sample metadata

Marker Measurement Units
Body site distal gut content None
Experiment metagenomics None
Index PCR cycles 9 None
Lab Process ID LPS00776 None
Omics Metagenomics None
Organism Salmon None
Pool S-MG-P9-525 None
Project HoloFood None
Raw seq. name S-MG-P9-525/V300074223_L01_525 None
Sample code SA07.27C1a None
Sequencing company BGI None

Treatment metadata

Marker Measurement Units
Treatment code Jaguar None
Treatment concentration 2.0% %
Treatment description Fermented algae meal (added in in oil coating) None

Trial metadata

Marker Measurement Units
Environment Tanks (flow-through) None
Trial code SA None
Trial description Trial A: Seaweed-dose response None
Trial end 2019-08-13 None
Trial start 2019-06-11 None
Metagenomics

Sample SAMEA7687990 may have been analysed by MGnify. Lookup sample on MGnify

Analyses

Analysis accession Run/assembly accession MGnify pipeline version Experiment type Detail
MGYA00606373 ERR4918475 5.0 metagenomic View on MGnify
MGYA00608150 ERZ2627065 5.0 assembly View on MGnify
Nucleotide sequencing data

Sample SAMEA7687990 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 133,083,110bp sequenced by 913,562 reads. View sample SAMEA7687990 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA7687990 SA07.27C1a
Reads (Run) ERR4918475 webin-reads-SA07_27C1a_metaG
Reads (Experiment) ERX4783384 DNBSEQ-G400 paired end sequencing: Raw reads: SA07_27C1a_metaG
Project/Study PRJEB41657 HoloFood Salmon Trial A+B Gut Metagenome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA7687990