HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA7571781: CA14.09F1a

Sample data for SAMEA7571781, a HoloFood metagenomic-assembly chicken sample


Sample details
Animal
Chicken SAMEA112904970
Sample type
Metagenomic / metatranscriptomic data icon metagenomic-assembly
API endpoint
/api/samples/SAMEA7571781 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA7571781, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA7571781 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:21:26Z None
INSDC last update 2023-03-22T12:21:26Z None
INSDC status public None
SRA accession ERS5328402 None
Submitter Id CA14_09F1a_metaG None
adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT None
collection date 2019-02-25 None
description Prior chicken data from Caecum content; animal CA14.09 from cage CA14 with treatment CC None
geographic location (country and/or sea) Spain None
geographic location (latitude) 41.17 DD
geographic location (longitude) 1.1685 DD
geographic location (region and locality) El Morell; Tarragona None
host body site Caecum content None
host breed Ross None
host common name Chicken None
host diet treatment Control None
host disease status Campylobacter:NS;Salmonella:NS;Clostridium:NS None
host scientific name Gallus gallus None
host sex female None
host storage container temperature 21 °C
host subject id CA14.09 None
host taxid 9031 None
host total mass 820.2 g
nucleic acid extraction D-rex protocol None
organism chicken gut metagenome None
project HoloFood None
project name HoloFood Chicken - Prior Chicken None
reference host genome for decontamination GCF_000002315.6 None
sample storage buffer Shield None
sample storage container E-matrix 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name chicken gut metagenome None
sequencing method MGISEQ-2000 None
title CA14.09F1a None
trial length 35 day
trial timepoint 21 day

Sample metadata

Marker Measurement Units
Body site caecum content None
Experiment metagenomics None
Index PCR cycles 6 None
Lab Process ID LPC00065 None
Organism Chicken None
Pool PRICH-04BM-519 None
Project HoloFood None
Raw sequence name F20FTSEUET0072_GALojaR/PRICH-04BM-519/V300066406_L02_519 None
Sample code CA14.09F1a None
Sequencing company BGI None
ng used for library build 379.5 None

Treatment metadata

Marker Measurement Units
Treatment code CC None
Treatment name Control None

Trial metadata

Marker Measurement Units
Trial code CA None
Trial description Trial 1 None
Trial end 2019-03-11 None
Trial start 2019-02-04 None
Metagenomics

Sample SAMEA7571781 may have been analysed by MGnify. Lookup sample on MGnify

Analyses

Analysis accession Run/assembly accession MGnify pipeline version Experiment type Detail
MGYA00615997 ERZ2916527 5.0 assembly View on MGnify
Nucleotide sequencing data

Sample SAMEA7571781 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 5,451,215,708bp sequenced by 37,355,912 reads. View sample SAMEA7571781 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA7571781 CA14.09F1a
Reads (Run) ERR4835857 webin-reads-CA14_09F1a_metaG
Reads (Experiment) ERX4705635 DNBSEQ-G400 paired end sequencing: Raw reads: CA14_09F1a_metaG
Project/Study PRJEB41323 HoloFood Chicken Caecum Metagenome – deeply sequenced batch

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA7571781