Could not connect to MGnify right now. Please try later.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA7368187, a HoloFood metagenomic-assembly chicken sample
Metadata for sample SAMEA7368187, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2022-08-02 | None |
| ENA-LAST-UPDATE | 2022-08-02 | None |
| External Id | SAMEA7368187 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2022-08-02T16:46:20Z | None |
| INSDC last update | 2022-08-02T16:46:20Z | None |
| INSDC status | public | None |
| Organism | Gallus gallus | None |
| SRA accession | ERS5126640 | None |
| Submitter Id | CC19_18C1a_metaG | None |
| adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT | None |
| collection date | 2019-10-16 | None |
| description | chicken MAG catalogue data from Ileum content; animal CC19.18 from cage CC19 with treatment CC | None |
| geographic location (country and/or sea) | Spain | None |
| geographic location (latitude) | 41.17 | DD |
| geographic location (longitude) | 1.1685 | DD |
| geographic location (region and locality) | El Morell; Tarragona | None |
| host body site | Ileum content | None |
| host breed | Ross | None |
| host common name | Chicken | None |
| host diet treatment | Control | None |
| host scientific name | Gallus gallus | None |
| host sex | male | None |
| host storage container temperature | 21 | °C |
| host subject id | CC19.18 | None |
| host taxid | 9031 | None |
| host total mass | 2046 | g |
| nucleic acid extraction | D-rex protocol | None |
| organism | chicken gut metagenome | None |
| project | HoloFood | None |
| project name | HoloFood Chicken - MAG Catalogue from Ileum content | None |
| reference host genome for decontamination | GCF_000002315.6 | None |
| sample storage buffer | Shield | None |
| sample storage container | E-matrix 2ml | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| sequencing method | MGISEQ-2000 | None |
| title | CC19.18C1a | None |
| trial length | 35 | day |
| trial timepoint | 35 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | ileum content | None |
| Experiment | metagenomics | None |
| Index PCR cycles | 6 | None |
| Lab Process ID | LPC00217 | None |
| Organism | Chicken | None |
| Pool | IC-MAG-11-528 | None |
| Project | HoloFood | None |
| Raw sequence name | F20FTSEUET0072_MICfuxR/IC-MAG-11/200707_I051_V300047602_L3_CDK153B200629007-528/V300047602_L03 | None |
| Sample code | CC19.18C1a | None |
| Sequencing company | BGI | None |
| ng used for library build | 130.6 | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | CC | None |
| Treatment name | Control | None |
| Marker | Measurement | Units |
|---|---|---|
| Trial code | CC | None |
| Trial description | Trial 3 | None |
| Trial end | 2019-07-14 | None |
| Trial start | 2019-06-09 | None |
Sample SAMEA7368187 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
|---|
No analyses found in MGnify
Sample SAMEA7368187 has nucleotide sequencing data in the European Nucleotide Archive (ENA): Unknownbp sequenced by unknown reads. View sample SAMEA7368187 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA7368187 | |
| Reads (Run) | ||
| Reads (Experiment) | ||
| Project/Study |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA7368187