HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA14099424: CC21.07F1a

Sample data for SAMEA14099424, a HoloFood metagenomic-assembly chicken sample


Sample details
Animal
Chicken SAMEA112905085
Sample type
Metagenomic / metatranscriptomic data icon metagenomic-assembly
API endpoint
/api/samples/SAMEA14099424 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA14099424, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA14099424 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:22:39Z None
INSDC last update 2023-03-22T12:22:39Z None
INSDC status public None
SRA accession ERS11702512 None
Submitter Id CC21_07F1a_EC_rev_metaG None
adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC None
collection date 2019-09-30 None
common name Extreme chicken caecum content None
description main associated run/experiment: ERR9612719/ERX9162942, merged from ERR4968598/ERX4787795 and ERR6748756/ERX6372704 (linked to this sample as well); Chicken meta genome data from Caecum content; animal CC21.07 from cage CC21 with treatment CE None
geographic location (country and/or sea) Spain None
geographic location (latitude) 41.17 DD
geographic location (longitude) 1.1685 DD
geographic location (region and locality) El Morell; Tarragona None
host body site Caecum content None
host breed Ross None
host common name Chicken None
host diet treatment Prebiotic None
host disease status Campylobacter:+;Salmonella:-;Clostridium:- None
host scientific name Gallus gallus None
host sex male None
host storage container temperature 21 °C
host subject id CC21.07 None
host taxid 9031 None
host total mass 940 g
library name BEMT None
library selection PCR None
nucleic acid extraction D-rex protocol None
organism chicken gut metagenome None
project HoloFood None
project name HoloFood Chicken -- Extreme Chicken None
reference host genome for decontamination GCF_000002315.6 None
sample storage buffer Shield None
sample storage container E-matrix 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name chicken gut metagenome None
sequencing method MGISEQ-2000 None
title CC21.07F1a None
trial length 35 day
trial timepoint 21 day

Sample metadata

Marker Measurement Units
Body site caecum content None
Experiment metagenomics None
Index PCR cycles 8 None
Lab Process ID LPC00133 None
Organism Chicken None
Pool PRICH-20BM-505 None
Project HoloFood None
Raw sequence name F20FTSEUHT1189_GALkbvR/PRICH-20BM/PRICH-20BM-505 None
Sample code CC21.07F1a None
Sequencing company BGI None
ng used for library build 301.44 None

Treatment metadata

Marker Measurement Units
Treatment code CE None
Treatment name Prebiotic None

Trial metadata

Marker Measurement Units
Trial code CC None
Trial description Trial 3 None
Trial end 2019-07-14 None
Trial start 2019-06-09 None
Metagenomics

Sample SAMEA14099424 may have been analysed by MGnify. Lookup sample on MGnify

Analyses

Analysis accession Run/assembly accession MGnify pipeline version Experiment type Detail
MGYA00635941 ERZ2916408 5.0 assembly View on MGnify
MGYA00688210 ERR9612719 5.0 metagenomic View on MGnify
Nucleotide sequencing data

Sample SAMEA14099424 has nucleotide sequencing data in the European Nucleotide Archive (ENA): Unknownbp sequenced by unknown reads. View sample SAMEA14099424 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA14099424
Reads (Run)
Reads (Experiment)
Project/Study

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA14099424