No analyses found in MGnify
HoloFood Data Portal
Access samples and data collected and generated by the HoloFood project.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA14095991, a HoloFood metagenomic-assembly chicken sample
Metadata for sample SAMEA14095991, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-03-22 | None |
| ENA-LAST-UPDATE | 2023-03-22 | None |
| External Id | SAMEA14095991 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-03-22T12:22:39Z | None |
| INSDC last update | 2023-03-22T12:22:39Z | None |
| INSDC status | public | None |
| SRA accession | ERS11699100 | None |
| Submitter Id | CB06_16F1a_metaG_reseq | None |
| adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC | None |
| collection date | 2019-06-04 | None |
| common name | Priority chicken caecum content | None |
| description | duplicate of CB06.16F1a (ERR4993662/ERX4803148); Chicken meta genome data from Caecum content; animal CB06.16 from cage CB06 with treatment CC | None |
| geographic location (country and/or sea) | Spain | None |
| geographic location (latitude) | 41.17 | DD |
| geographic location (longitude) | 1.1685 | DD |
| geographic location (region and locality) | El Morell; Tarragona | None |
| host body site | Caecum content | None |
| host breed | Cobb | None |
| host common name | Chicken | None |
| host diet treatment | Control | None |
| host disease status | Campylobacter:-;Salmonella:-;Clostridium:- | None |
| host scientific name | Gallus gallus | None |
| host sex | female | None |
| host storage container temperature | 21 | °C |
| host subject id | CB06.16 | None |
| host taxid | 9031 | None |
| host total mass | 2099.6 | g |
| library name | BEMT | None |
| library selection | PCR | None |
| nucleic acid extraction | D-rex protocol | None |
| organism | chicken gut metagenome | None |
| project | HoloFood | None |
| project name | HoloFood Chicken - Prior Chicken | None |
| reference host genome for decontamination | GCF_000002315.6 | None |
| sample storage buffer | Shield | None |
| sample storage container | E-matrix 2ml | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | chicken gut metagenome | None |
| sequencing method | MGISEQ-2000 | None |
| title | CB06.16F1a_reseq | None |
| trial length | 35 | day |
| trial timepoint | 35 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | caecum content | None |
| Experiment | metagenomics | None |
| Index PCR cycles | 12 | None |
| Lab Process ID | LPC00206 | None |
| Organism | Chicken | None |
| Pool | PRICH-12BM-524 | None |
| Project | HoloFood | None |
| Raw sequence name | F20FTSEUET0072_GALpdyR/PRICH-12BM-524/V300066507_L01_524 | None |
| Sample code | CB06.16F1a | None |
| Sequencing company | BGI | None |
| ng used for library build | 382.4 | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | CC | None |
| Treatment name | Control | None |
| Marker | Measurement | Units |
|---|---|---|
| Trial code | CB | None |
| Trial description | Trial 2 | None |
| Trial end | 2019-05-19 | None |
| Trial start | 2019-04-21 | None |
Sample SAMEA14095991 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
|---|
No analyses found in MGnify
Sample SAMEA14095991 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 33,340,196,241bp sequenced by 230,549,056 reads. View sample SAMEA14095991 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA14095991 | CB06.16F1a_reseq |
| Reads (Run) | ERR9610042 | webin-reads-CB06_16F1a_metaG_reseq |
| Reads (Experiment) | ERX9160272 | DNBSEQ-G400 sequencing: Raw reads: CB06_16F1a_metaG_reseq |
| Project/Study | PRJEB41323 | HoloFood Chicken Caecum Metagenome – deeply sequenced batch |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA14095991