HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA13929810: CC18.07F1a_MetaT

Sample data for SAMEA13929810, a HoloFood metatranscriptomic chicken sample


Sample details
Animal
Chicken SAMEA112904958
Sample type
Metagenomic / metatranscriptomic data icon metatranscriptomic
API endpoint
/api/samples/SAMEA13929810 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA13929810, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA13929810 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:22:36Z None
INSDC last update 2023-03-22T12:22:36Z None
INSDC status public None
SRA accession ERS11530218 None
Submitter Id CC18_07F1a_RAW_MetaT None
adapters AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT None
collection date 2019-09-30 None
common name Chicken Meta Transcriptome None
description Chicken meta transcriptome data from Caecum content; animal CC18.07 from cage CC18 with treatment CO; Raw data None
geographic location (country and/or sea) Spain None
geographic location (latitude) 41.17 DD
geographic location (longitude) 1.1685 DD
geographic location (region and locality) El Morell; Tarragona None
host body site Caecum content None
host breed Ross None
host common name Chicken None
host diet treatment Probiotic None
host disease status Campylobacter:+;Salmonella:-;Clostridium:- None
host scientific name Gallus gallus None
host sex male None
host storage container temperature 21 °C
host subject id CC18.07 None
host taxid 9031 None
host total mass 788 g
library name Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit None
library selection cDNA_randomPriming None
nucleic acid extraction D-rex protocol None
organism chicken gut metagenome None
project HoloFood None
project name HoloFood Chicken - Meta Transcriptome None
reference host genome for decontamination GCF_000000000.0 None
sample storage buffer Shield None
sample storage container E-matrix 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name chicken gut metagenome None
sequencing method Illumina NovaSeq 6000 None
title CC18.07F1a_MetaT None
trial length 35 day
trial timepoint 21 day

Sample metadata

Marker Measurement Units
Body site caecum content None
Experiment metatranscriptomics None
Index PCR cycles 8 None
Lab Process ID LPC00125 None
Organism Chicken None
Pool PRICH-21BM-512 None
Project HoloFood None
Raw sequence name F20FTSEUHT1189_GALkbvR/PRICH-21BM/PRICH-21BM-512 None
Sample code CC18.07F1a None
Sequencing company BGI None
ng used for library build 82.9 None

Treatment metadata

Marker Measurement Units
Treatment code CO None
Treatment name Probiotic None

Trial metadata

Marker Measurement Units
Trial code CC None
Trial description Trial 3 None
Trial end 2019-07-14 None
Trial start 2019-06-09 None
Metagenomics

Sample SAMEA13929810 may have been analysed by MGnify. Lookup sample on MGnify

Analyses

Empty set icon

Could not connect to MGnify right now. Please try later.

Analysis accession Run/assembly accession MGnify pipeline version Experiment type Detail
Empty set icon

No analyses found in MGnify

Nucleotide sequencing data

Sample SAMEA13929810 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 11,233,021,800bp sequenced by 74,886,812 reads. View sample SAMEA13929810 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA13929810 CC18.07F1a_MetaT
Reads (Run) ERR9525728 webin-reads-CC18_07F1a_RAW_MetaT
Reads (Experiment) ERX9067171 Illumina NovaSeq 6000 sequencing: Raw reads: CC18_07F1a_RAW_MetaT
Project/Study PRJEB52139 HoloFood Chicken Caecum Metatranscriptome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13929810