Could not connect to MGnify right now. Please try later.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA13929793, a HoloFood metatranscriptomic chicken sample
Metadata for sample SAMEA13929793, stored in BioSamples and ENA.
Download all as TSVMarker | Measurement | Units |
---|---|---|
ENA-CHECKLIST | ERC000052 | None |
ENA-FIRST-PUBLIC | 2023-03-22 | None |
ENA-LAST-UPDATE | 2023-03-22 | None |
External Id | SAMEA13929793 | None |
INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
INSDC center name | UNIVERSITY OF COPENHAGEN | None |
INSDC first public | 2023-03-22T12:22:36Z | None |
INSDC last update | 2023-03-22T12:22:36Z | None |
INSDC status | public | None |
SRA accession | ERS11530201 | None |
Submitter Id | CC05_15F1a_RAW_MetaT | None |
adapters | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | None |
collection date | 2019-10-15 | None |
common name | Chicken Meta Transcriptome | None |
description | Chicken meta transcriptome data from Caecum content; animal CC05.15 from cage CC05 with treatment CE; Raw data | None |
geographic location (country and/or sea) | Spain | None |
geographic location (latitude) | 41.17 | DD |
geographic location (longitude) | 1.1685 | DD |
geographic location (region and locality) | El Morell; Tarragona | None |
host body site | Caecum content | None |
host breed | Cobb | None |
host common name | Chicken | None |
host diet treatment | Prebiotic | None |
host disease status | Campylobacter:+;Salmonella:-;Clostridium:- | None |
host scientific name | Gallus gallus | None |
host sex | female | None |
host storage container temperature | 21 | °C |
host subject id | CC05.15 | None |
host taxid | 9031 | None |
host total mass | 2010 | g |
library name | Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit | None |
library selection | cDNA_randomPriming | None |
nucleic acid extraction | D-rex protocol | None |
organism | chicken gut metagenome | None |
project | HoloFood | None |
project name | HoloFood Chicken - Meta Transcriptome | None |
reference host genome for decontamination | GCF_000000000.0 | None |
sample storage buffer | Shield | None |
sample storage container | E-matrix 2ml | None |
sample storage location | UCPH | None |
sample storage temperature | -20 | °C |
sample volume or weight for DNA extraction | 0.2 | mL |
scientific_name | chicken gut metagenome | None |
sequencing method | Illumina NovaSeq 6000 | None |
title | CC05.15F1a_MetaT | None |
trial length | 35 | day |
trial timepoint | 35 | day |
Marker | Measurement | Units |
---|---|---|
Body site | caecum content | None |
Experiment | metatranscriptomics | None |
Index PCR cycles | 6 | None |
Lab Process ID | LPC00159 | None |
Organism | Chicken | None |
Pool | PRICH-17BM-526 | None |
Project | HoloFood | None |
Raw sequence name | F20FTSEUHT1189_GALkbvR/PRICH-17BM/PRICH-17BM-526 | None |
Sample code | CC05.15F1a | None |
Sequencing company | BGI | None |
ng used for library build | 364.8 | None |
Marker | Measurement | Units |
---|---|---|
Treatment code | CE | None |
Treatment name | Prebiotic | None |
Marker | Measurement | Units |
---|---|---|
Trial code | CC | None |
Trial description | Trial 3 | None |
Trial end | 2019-07-14 | None |
Trial start | 2019-06-09 | None |
Sample SAMEA13929793 may have been analysed by MGnify. Lookup sample on MGnify
Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
---|
No analyses found in MGnify
Sample SAMEA13929793 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 11,263,647,300bp sequenced by 75,090,982 reads. View sample SAMEA13929793 in ENA
Data domain | Accession | Title/alias |
---|---|---|
Sample | SAMEA13929793 | CC05.15F1a_MetaT |
Reads (Run) | ERR9525720 | webin-reads-CC05_15F1a_RAW_MetaT |
Reads (Experiment) | ERX9067163 | Illumina NovaSeq 6000 sequencing: Raw reads: CC05_15F1a_RAW_MetaT |
Project/Study | PRJEB52139 | HoloFood Chicken Caecum Metatranscriptome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13929793