HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA13929785: CB20.13F1a_MetaT

Sample data for SAMEA13929785, a HoloFood metatranscriptomic chicken sample


Sample details
Animal
Chicken SAMEA112904746
Sample type
Metagenomic / metatranscriptomic data icon metatranscriptomic
API endpoint
/api/samples/SAMEA13929785 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA13929785, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA13929785 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:22:36Z None
INSDC last update 2023-03-22T12:22:36Z None
INSDC status public None
SRA accession ERS11530193 None
Submitter Id CB20_13F1a_RAW_MetaT None
adapters AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT None
collection date 2019-06-03 None
common name Chicken Meta Transcriptome None
description Chicken meta transcriptome data from Caecum content; animal CB20.13 from cage CB20 with treatment CC; Raw data None
geographic location (country and/or sea) Spain None
geographic location (latitude) 41.17 DD
geographic location (longitude) 1.1685 DD
geographic location (region and locality) El Morell; Tarragona None
host body site Caecum content None
host breed Ross None
host common name Chicken None
host diet treatment Control None
host disease status Campylobacter:-;Salmonella:-;Clostridium:- None
host scientific name Gallus gallus None
host sex male None
host storage container temperature 21 °C
host subject id CB20.13 None
host taxid 9031 None
host total mass 2059.1 g
library name Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit None
library selection cDNA_randomPriming None
nucleic acid extraction D-rex protocol None
organism chicken gut metagenome None
project HoloFood None
project name HoloFood Chicken - Meta Transcriptome None
reference host genome for decontamination GCF_000000000.0 None
sample storage buffer Shield None
sample storage container E-matrix 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name chicken gut metagenome None
sequencing method Illumina NovaSeq 6000 None
title CB20.13F1a_MetaT None
trial length 35 day
trial timepoint 35 day

Sample metadata

Marker Measurement Units
Body site caecum content None
Experiment metatranscriptomics None
Index PCR cycles 8 None
Lab Process ID LPC00027 None
Organism Chicken None
Pool PRICH-12BM-521 None
Project HoloFood None
Raw sequence name F20FTSEUET0072_GALpdyR/PRICH-12BM-521/V300066507_L01_521 None
Sample code CB20.13F1a None
Sequencing company BGI None
ng used for library build 336 None

Treatment metadata

Marker Measurement Units
Treatment code CC None
Treatment name Control None

Trial metadata

Marker Measurement Units
Trial code CB None
Trial description Trial 2 None
Trial end 2019-05-19 None
Trial start 2019-04-21 None
Metagenomics

Sample SAMEA13929785 may have been analysed by MGnify. Lookup sample on MGnify

Analyses

Empty set icon

Could not connect to MGnify right now. Please try later.

Analysis accession Run/assembly accession MGnify pipeline version Experiment type Detail
Empty set icon

No analyses found in MGnify

Nucleotide sequencing data

Sample SAMEA13929785 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 14,634,405,600bp sequenced by 97,562,704 reads. View sample SAMEA13929785 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA13929785 CB20.13F1a_MetaT
Reads (Run) ERR9526611 webin-reads-CB20_13F1a_RAW_MetaT
Reads (Experiment) ERX9067502 Illumina NovaSeq 6000 sequencing: Raw reads: CB20_13F1a_RAW_MetaT
Project/Study PRJEB52139 HoloFood Chicken Caecum Metatranscriptome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13929785