Could not connect to MGnify right now. Please try later.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA13929768, a HoloFood metatranscriptomic chicken sample
Metadata for sample SAMEA13929768, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-03-22 | None |
| ENA-LAST-UPDATE | 2023-03-22 | None |
| External Id | SAMEA13929768 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-03-22T12:22:36Z | None |
| INSDC last update | 2023-03-22T12:22:36Z | None |
| INSDC status | public | None |
| SRA accession | ERS11530176 | None |
| Submitter Id | CA11_18F1a_RAW_MetaT | None |
| adapters | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | None |
| collection date | 2019-03-13 | None |
| common name | Chicken Meta Transcriptome | None |
| description | Chicken meta transcriptome data from Caecum content; animal CA11.18 from cage CA11 with treatment CC; Raw data | None |
| geographic location (country and/or sea) | Spain | None |
| geographic location (latitude) | 41.17 | DD |
| geographic location (longitude) | 1.1685 | DD |
| geographic location (region and locality) | El Morell; Tarragona | None |
| host body site | Caecum content | None |
| host breed | Ross | None |
| host common name | Chicken | None |
| host diet treatment | Control | None |
| host disease status | Campylobacter:-;Salmonella:-;Clostridium:- | None |
| host scientific name | Gallus gallus | None |
| host sex | male | None |
| host storage container temperature | 21 | °C |
| host subject id | CA11.18 | None |
| host taxid | 9031 | None |
| host total mass | 2189 | g |
| library name | Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit | None |
| library selection | cDNA_randomPriming | None |
| nucleic acid extraction | D-rex protocol | None |
| organism | chicken gut metagenome | None |
| project | HoloFood | None |
| project name | HoloFood Chicken - Meta Transcriptome | None |
| reference host genome for decontamination | GCF_000000000.0 | None |
| sample storage buffer | Shield | None |
| sample storage container | E-matrix 2ml | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | chicken gut metagenome | None |
| sequencing method | Illumina NovaSeq 6000 | None |
| title | CA11.18F1a_MetaT | None |
| trial length | 35 | day |
| trial timepoint | 35 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | caecum content | None |
| Experiment | metatranscriptomics | None |
| Index PCR cycles | 6 | None |
| Lab Process ID | LPC00098 | None |
| Organism | Chicken | None |
| Pool | PRICH-08BM-501 | None |
| Project | HoloFood | None |
| Raw sequence name | F20FTSEUET0072_GALojaR/PRICH-08BM-501/V300067888_L04_501 | None |
| Sample code | CA11.18F1a | None |
| Sequencing company | BGI | None |
| ng used for library build | 324.76 | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | CC | None |
| Treatment name | Control | None |
| Marker | Measurement | Units |
|---|---|---|
| Trial code | CA | None |
| Trial description | Trial 1 | None |
| Trial end | 2019-03-11 | None |
| Trial start | 2019-02-04 | None |
Sample SAMEA13929768 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
|---|
No analyses found in MGnify
Sample SAMEA13929768 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 10,176,317,100bp sequenced by 67,842,114 reads. View sample SAMEA13929768 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA13929768 | CA11.18F1a_MetaT |
| Reads (Run) | ERR9525968 | webin-reads-CA11_18F1a_RAW_MetaT |
| Reads (Experiment) | ERX9067411 | Illumina NovaSeq 6000 sequencing: Raw reads: CA11_18F1a_RAW_MetaT |
| Project/Study | PRJEB52139 | HoloFood Chicken Caecum Metatranscriptome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13929768