HoloFood Data Portal
Access samples and data collected and generated by the HoloFood project.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA13901780, a HoloFood transcriptomic chicken sample
Metadata for sample SAMEA13901780, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-03-22 | None |
| ENA-LAST-UPDATE | 2023-03-22 | None |
| External Id | SAMEA13901780 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-03-22T12:22:35Z | None |
| INSDC last update | 2023-03-22T12:22:35Z | None |
| INSDC status | public | None |
| SRA accession | ERS11502229 | None |
| Submitter Id | CC23_07B1a_RAW_HostT | None |
| adapters | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | None |
| collection date | 2019-09-30 | None |
| common name | chicken | None |
| description | Chicken host transcriptome data from Ileum mucosa; animal CC23.07 from cage CC23 with treatment CE; Raw data | None |
| geographic location (country and/or sea) | Spain | None |
| geographic location (latitude) | 41.17 | DD |
| geographic location (longitude) | 1.1685 | DD |
| geographic location (region and locality) | El Morell; Tarragona | None |
| host body site | Ileum mucosa | None |
| host breed | Cobb | None |
| host common name | Chicken | None |
| host diet treatment | Prebiotic | None |
| host disease status | Campylobacter:+;Salmonella:-;Clostridium:- | None |
| host scientific name | Gallus gallus | None |
| host sex | male | None |
| host storage container temperature | 21 | °C |
| host subject id | CC23.07 | None |
| host taxid | 9031 | None |
| host total mass | 940 | g |
| library name | Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit | None |
| library selection | cDNA | None |
| nucleic acid extraction | D-rex protocol | None |
| organism | Gallus gallus | None |
| project | HoloFood | None |
| project name | HoloFood Chicken - Host Transcriptome | None |
| reference host genome for decontamination | GCF_000000000.0 | None |
| sample storage buffer | Shield | None |
| sample storage container | E-matrix 2ml | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | Gallus gallus | None |
| sequencing method | Illumina NovaSeq 6000 | None |
| title | CC23.07B1a_HostT | None |
| trial length | 35 | day |
| trial timepoint | 21 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | ileum mucosa | None |
| Experiment | transcriptomics | None |
| Organism | Chicken | None |
| Project | HoloFood | None |
| Sample code | CC23.07B1a | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | CE | None |
| Treatment name | Prebiotic | None |
| Marker | Measurement | Units |
|---|---|---|
| Trial code | CC | None |
| Trial description | Trial 3 | None |
| Trial end | 2019-07-14 | None |
| Trial start | 2019-06-09 | None |
Sample SAMEA13901780 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 6,222,519,000bp sequenced by 41,483,460 reads. View sample SAMEA13901780 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA13901780 | CC23.07B1a_HostT |
| Reads (Run) | ERR9516455 | webin-reads-CC23_07B1a_RAW_HostT |
| Reads (Experiment) | ERX9057994 | Illumina NovaSeq 6000 sequencing: Raw reads: CC23_07B1a_RAW_HostT |
| Project/Study | PRJEB52095 | HoloFood Chicken Host Transcriptome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13901780
